Incidental Mutation 'R6653:Mfsd13a'
ID526541
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R6653 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46367866 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 137 (F137L)
Ref Sequence ENSEMBL: ENSMUSP00000119072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably damaging
Transcript: ENSMUST00000086969
AA Change: F137L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128041
AA Change: F137L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137143
Predicted Effect probably damaging
Transcript: ENSMUST00000142994
AA Change: F137L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,346,006 L435R probably benign Het
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Ankhd1 A T 18: 36,600,783 probably null Het
Ankrd50 T A 3: 38,457,361 I286F probably damaging Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
B4galnt2 T A 11: 95,891,921 M22L probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
Cdh4 C T 2: 179,780,428 A115V probably benign Het
Cfap53 A G 18: 74,300,209 T122A probably damaging Het
Chsy1 A G 7: 66,110,193 K95E probably benign Het
Csde1 C A 3: 103,052,868 P604T probably damaging Het
Cts7 A T 13: 61,355,003 L237Q probably damaging Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eif2b4 C T 5: 31,192,207 E53K possibly damaging Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fcamr A G 1: 130,813,202 T453A possibly damaging Het
Glb1l3 T C 9: 26,859,588 T61A probably benign Het
Gpr26 T C 7: 131,984,101 S267P probably benign Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hephl1 C T 9: 15,081,964 V525I probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kbtbd4 T A 2: 90,909,769 Y499* probably null Het
Kif1a A T 1: 93,077,698 I118N probably damaging Het
Klhdc7b A G 15: 89,387,089 S725G probably benign Het
Myo7a T A 7: 98,054,503 Y1977F probably damaging Het
Naip2 C T 13: 100,152,136 V1194I probably benign Het
Naip2 T G 13: 100,161,844 K561N probably benign Het
Nkx2-4 G T 2: 147,083,940 A334E possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Pcdha7 A G 18: 36,974,486 Q188R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phip C A 9: 82,900,741 E884* probably null Het
Plxnc1 C A 10: 94,943,876 V235L probably damaging Het
Qser1 A G 2: 104,780,260 V1226A possibly damaging Het
Ros1 G T 10: 52,142,203 S786R probably damaging Het
Rps6ka5 A G 12: 100,551,536 S769P probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Specc1 T G 11: 62,146,418 S813A probably damaging Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Tmem44 T C 16: 30,537,551 D110G probably damaging Het
Ubn2 A G 6: 38,434,462 E97G possibly damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Usp25 T A 16: 77,059,288 N256K probably benign Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Wnt2b C A 3: 104,953,186 R135L probably damaging Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1367:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R2985:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3416:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 splice site probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
R7525:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7976:Mfsd13a UTSW 19 46372007 missense probably benign 0.03
R8696:Mfsd13a UTSW 19 46368118 missense probably benign
R8771:Mfsd13a UTSW 19 46372229 missense probably damaging 0.99
R8857:Mfsd13a UTSW 19 46368128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGGTGTAAAGGTTACCTCC -3'
(R):5'- TTGTGTGGTTCCCAGAAAGCC -3'

Sequencing Primer
(F):5'- CTGGTGTAAAGGTTACCTCCTAACAC -3'
(R):5'- GCAGCTAGTACCACACAGAAGG -3'
Posted On2018-07-23