Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:Gm4847'

526542

Institutional Source

Beutler Lab

Gene Symbol

Gm4847

Ensembl Gene

ENSMUSG00000051081

Gene Name

predicted gene 4847

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

166628971-166647693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 166630387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 466 (G466C)

Ref Sequence

ENSEMBL: ENSMUSP00000039839 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046662]

AlphaFold

G3X946

Predicted Effect

probably damaging
Transcript: ENSMUST00000046662
AA Change: G466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039839
Gene: ENSMUSG00000051081
AA Change: G466C

Domain	Start	End	E-Value	Type
Pfam:FMO-like	3	533	1.4e-235	PFAM
Pfam:Pyr_redox_2	4	241	5.2e-11	PFAM
Pfam:Pyr_redox_3	7	221	6.7e-15	PFAM
Pfam:NAD_binding_8	8	92	1.6e-7	PFAM
Pfam:K_oxygenase	77	333	5.2e-9	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Gm4847

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00726:Gm4847	APN	1	166630392	missense	possibly damaging	0.55
IGL00943:Gm4847	APN	1	166642353	missense	probably benign	0.01
IGL00948:Gm4847	APN	1	166630338	missense	probably benign	0.01
IGL01146:Gm4847	APN	1	166634952	missense	probably damaging	1.00
IGL01345:Gm4847	APN	1	166634972	missense	probably damaging	1.00
IGL01654:Gm4847	APN	1	166638348	missense	probably damaging	1.00
IGL01817:Gm4847	APN	1	166634902	missense	probably damaging	1.00
IGL02028:Gm4847	APN	1	166642196	missense	probably benign	0.23
IGL02031:Gm4847	APN	1	166635009	missense	probably damaging	1.00
IGL02412:Gm4847	APN	1	166641738	missense	probably damaging	0.98
IGL03278:Gm4847	APN	1	166635036	missense	probably benign	0.06
PIT4494001:Gm4847	UTSW	1	166640018	missense	probably damaging	1.00
R0009:Gm4847	UTSW	1	166630486	missense	probably benign	0.00
R0009:Gm4847	UTSW	1	166630486	missense	probably benign	0.00
R0121:Gm4847	UTSW	1	166642288	missense	probably damaging	1.00
R0492:Gm4847	UTSW	1	166630392	missense	probably damaging	1.00
R0973:Gm4847	UTSW	1	166630255	missense	probably benign	0.07
R1136:Gm4847	UTSW	1	166630366	missense	probably damaging	0.98
R1522:Gm4847	UTSW	1	166641650	missense	probably damaging	1.00
R1730:Gm4847	UTSW	1	166638339	missense	possibly damaging	0.80
R1818:Gm4847	UTSW	1	166638219	missense	probably damaging	1.00
R1819:Gm4847	UTSW	1	166638219	missense	probably damaging	1.00
R2145:Gm4847	UTSW	1	166634903	missense	probably benign	0.00
R4628:Gm4847	UTSW	1	166630395	missense	probably damaging	1.00
R4850:Gm4847	UTSW	1	166642339	missense	probably damaging	1.00
R5065:Gm4847	UTSW	1	166634790	missense	probably damaging	0.99
R5068:Gm4847	UTSW	1	166638384	missense	possibly damaging	0.81
R5493:Gm4847	UTSW	1	166630321	missense	probably damaging	1.00
R5500:Gm4847	UTSW	1	166635042	missense	probably damaging	1.00
R5990:Gm4847	UTSW	1	166643373	missense	probably benign	0.00
R6018:Gm4847	UTSW	1	166643448	missense	probably damaging	1.00
R6178:Gm4847	UTSW	1	166642336	missense	probably damaging	1.00
R6190:Gm4847	UTSW	1	166630323	missense	probably damaging	0.98
R6220:Gm4847	UTSW	1	166634972	missense	probably damaging	1.00
R7634:Gm4847	UTSW	1	166632680	missense	probably benign
R7796:Gm4847	UTSW	1	166642250	missense	probably damaging	0.96
R7856:Gm4847	UTSW	1	166634826	missense	probably damaging	1.00
R7877:Gm4847	UTSW	1	166640006	missense	possibly damaging	0.48
R8130:Gm4847	UTSW	1	166638348	missense	probably damaging	1.00
R8361:Gm4847	UTSW	1	166642270	missense	possibly damaging	0.69
R8496:Gm4847	UTSW	1	166642192	missense	possibly damaging	0.84
R8935:Gm4847	UTSW	1	166642220	missense	probably damaging	1.00
R9023:Gm4847	UTSW	1	166641763	missense	probably damaging	1.00
R9055:Gm4847	UTSW	1	166640108	missense	probably damaging	1.00
R9310:Gm4847	UTSW	1	166632712	missense	probably benign
X0018:Gm4847	UTSW	1	166634950	missense	probably benign	0.24
X0024:Gm4847	UTSW	1	166632715	missense	possibly damaging	0.87
Z1177:Gm4847	UTSW	1	166634773	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTGTGCATTTGAAAACCCAG -3'
(R):5'- ACAGGACTGAAGTCTGATGTTTG -3'

Sequencing Primer
(F):5'- GTGATATGCATGATAACTACTACGG -3'
(R):5'- GATGTTTGTTGTGTTTCCATCCC -3'

Posted On

2018-07-23