Incidental Mutation 'R6654:Gm4847'
ID526542
Institutional Source Beutler Lab
Gene Symbol Gm4847
Ensembl Gene ENSMUSG00000051081
Gene Namepredicted gene 4847
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location166628971-166647693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 166630387 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 466 (G466C)
Ref Sequence ENSEMBL: ENSMUSP00000039839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046662]
Predicted Effect probably damaging
Transcript: ENSMUST00000046662
AA Change: G466C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039839
Gene: ENSMUSG00000051081
AA Change: G466C

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 1.4e-235 PFAM
Pfam:Pyr_redox_2 4 241 5.2e-11 PFAM
Pfam:Pyr_redox_3 7 221 6.7e-15 PFAM
Pfam:NAD_binding_8 8 92 1.6e-7 PFAM
Pfam:K_oxygenase 77 333 5.2e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Gm4847
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Gm4847 APN 1 166630392 missense possibly damaging 0.55
IGL00943:Gm4847 APN 1 166642353 missense probably benign 0.01
IGL00948:Gm4847 APN 1 166630338 missense probably benign 0.01
IGL01146:Gm4847 APN 1 166634952 missense probably damaging 1.00
IGL01345:Gm4847 APN 1 166634972 missense probably damaging 1.00
IGL01654:Gm4847 APN 1 166638348 missense probably damaging 1.00
IGL01817:Gm4847 APN 1 166634902 missense probably damaging 1.00
IGL02028:Gm4847 APN 1 166642196 missense probably benign 0.23
IGL02031:Gm4847 APN 1 166635009 missense probably damaging 1.00
IGL02412:Gm4847 APN 1 166641738 missense probably damaging 0.98
IGL03278:Gm4847 APN 1 166635036 missense probably benign 0.06
PIT4494001:Gm4847 UTSW 1 166640018 missense probably damaging 1.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0009:Gm4847 UTSW 1 166630486 missense probably benign 0.00
R0121:Gm4847 UTSW 1 166642288 missense probably damaging 1.00
R0492:Gm4847 UTSW 1 166630392 missense probably damaging 1.00
R0973:Gm4847 UTSW 1 166630255 missense probably benign 0.07
R1136:Gm4847 UTSW 1 166630366 missense probably damaging 0.98
R1522:Gm4847 UTSW 1 166641650 missense probably damaging 1.00
R1730:Gm4847 UTSW 1 166638339 missense possibly damaging 0.80
R1818:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R1819:Gm4847 UTSW 1 166638219 missense probably damaging 1.00
R2145:Gm4847 UTSW 1 166634903 missense probably benign 0.00
R4628:Gm4847 UTSW 1 166630395 missense probably damaging 1.00
R4850:Gm4847 UTSW 1 166642339 missense probably damaging 1.00
R5065:Gm4847 UTSW 1 166634790 missense probably damaging 0.99
R5068:Gm4847 UTSW 1 166638384 missense possibly damaging 0.81
R5493:Gm4847 UTSW 1 166630321 missense probably damaging 1.00
R5500:Gm4847 UTSW 1 166635042 missense probably damaging 1.00
R5990:Gm4847 UTSW 1 166643373 missense probably benign 0.00
R6018:Gm4847 UTSW 1 166643448 missense probably damaging 1.00
R6178:Gm4847 UTSW 1 166642336 missense probably damaging 1.00
R6190:Gm4847 UTSW 1 166630323 missense probably damaging 0.98
R6220:Gm4847 UTSW 1 166634972 missense probably damaging 1.00
R7634:Gm4847 UTSW 1 166632680 missense probably benign
R7796:Gm4847 UTSW 1 166642250 missense probably damaging 0.96
R7856:Gm4847 UTSW 1 166634826 missense probably damaging 1.00
R7877:Gm4847 UTSW 1 166640006 missense possibly damaging 0.48
R8130:Gm4847 UTSW 1 166638348 missense probably damaging 1.00
R8361:Gm4847 UTSW 1 166642270 missense possibly damaging 0.69
X0018:Gm4847 UTSW 1 166634950 missense probably benign 0.24
X0024:Gm4847 UTSW 1 166632715 missense possibly damaging 0.87
Z1177:Gm4847 UTSW 1 166634773 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTGCATTTGAAAACCCAG -3'
(R):5'- ACAGGACTGAAGTCTGATGTTTG -3'

Sequencing Primer
(F):5'- GTGATATGCATGATAACTACTACGG -3'
(R):5'- GATGTTTGTTGTGTTTCCATCCC -3'
Posted On2018-07-23