Incidental Mutation 'R6654:Olfr1109'
ID526543
Institutional Source Beutler Lab
Gene Symbol Olfr1109
Ensembl Gene ENSMUSG00000075161
Gene Nameolfactory receptor 1109
SynonymsMOR172-5, GA_x6K02T2Q125-48586461-48585523
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87091195-87096008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87093050 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000149282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099863] [ENSMUST00000214636] [ENSMUST00000217066]
Predicted Effect probably benign
Transcript: ENSMUST00000099863
AA Change: S116P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097449
Gene: ENSMUSG00000075161
AA Change: S116P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.3e-52 PFAM
Pfam:7tm_1 41 290 6.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214636
AA Change: S116P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217066
AA Change: S116P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Olfr1109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Olfr1109 APN 2 87093299 missense probably benign
IGL01926:Olfr1109 APN 2 87092974 missense probably damaging 1.00
IGL03195:Olfr1109 APN 2 87092569 missense probably damaging 1.00
R0550:Olfr1109 UTSW 2 87093129 missense probably benign 0.00
R1334:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R1677:Olfr1109 UTSW 2 87092737 missense probably benign
R1753:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R3933:Olfr1109 UTSW 2 87092762 missense probably benign 0.01
R4151:Olfr1109 UTSW 2 87093170 missense probably benign 0.07
R4296:Olfr1109 UTSW 2 87092630 missense probably benign 0.00
R6657:Olfr1109 UTSW 2 87093059 missense probably benign 0.00
R7697:Olfr1109 UTSW 2 87092818 missense probably benign 0.30
R8178:Olfr1109 UTSW 2 87092876 missense possibly damaging 0.94
R8413:Olfr1109 UTSW 2 87093158 missense probably benign 0.25
Z1176:Olfr1109 UTSW 2 87093224 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCACAACGTTGGGACCAC -3'
(R):5'- GGGTAACTGGGGAATGATCTTC -3'

Sequencing Primer
(F):5'- CGTTGGGACCACAGAAGTC -3'
(R):5'- GATCTGGTTGAATGCCCACC -3'
Posted On2018-07-23