Incidental Mutation 'R6654:Gm13757'
ID526544
Institutional Source Beutler Lab
Gene Symbol Gm13757
Ensembl Gene ENSMUSG00000090097
Gene Namepredicted gene 13757
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88442814-88449131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88446672 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 89 (T89P)
Ref Sequence ENSEMBL: ENSMUSP00000136580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126038] [ENSMUST00000179450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000126038
AA Change: T89P

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000179450
AA Change: T89P

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136580
Gene: ENSMUSG00000090097
AA Change: T89P

DomainStartEndE-ValueType
Pfam:7tm_4 26 303 1.4e-49 PFAM
Pfam:7tm_1 39 285 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Gm13757
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0241:Gm13757 UTSW 2 88446545 missense possibly damaging 0.48
R0627:Gm13757 UTSW 2 88446219 missense probably damaging 1.00
R0634:Gm13757 UTSW 2 88446617 missense probably benign 0.10
R1305:Gm13757 UTSW 2 88446302 nonsense probably null
R1353:Gm13757 UTSW 2 88446551 missense probably benign 0.42
R1765:Gm13757 UTSW 2 88446023 missense probably damaging 1.00
R1974:Gm13757 UTSW 2 88446509 missense probably damaging 0.97
R1990:Gm13757 UTSW 2 88446689 missense probably damaging 1.00
R2196:Gm13757 UTSW 2 88446710 missense probably benign 0.10
R2974:Gm13757 UTSW 2 88446574 nonsense probably null
R4794:Gm13757 UTSW 2 88446347 missense probably benign 0.12
R5495:Gm13757 UTSW 2 88446057 missense probably benign 0.03
R5771:Gm13757 UTSW 2 88446308 missense possibly damaging 0.94
R6756:Gm13757 UTSW 2 88446734 missense possibly damaging 0.78
R8070:Gm13757 UTSW 2 88446659 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTAGCATCATAACCTGGGG -3'
(R):5'- GGCTATCTTCCAAGCAGAACAC -3'

Sequencing Primer
(F):5'- CTAGCATCATAACCTGGGGAAAGG -3'
(R):5'- CCAAGCAGAACACTGAAGTATTTTGC -3'
Posted On2018-07-23