Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:4930430A15Rik'

526545

Institutional Source

Beutler Lab

Gene Symbol

4930430A15Rik

Ensembl Gene

ENSMUSG00000027157

Gene Name

RIKEN cDNA 4930430A15 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111162061-111229602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111171884 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 154 (M154L)

Ref Sequence

ENSEMBL: ENSMUSP00000117759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000142636]

Predicted Effect

unknown
Transcript: ENSMUST00000142636
AA Change: M154L

SMART Domains

Protein: ENSMUSP00000117759
Gene: ENSMUSG00000027157
AA Change: M154L

Domain	Start	End	E-Value	Type
internal_repeat_1	1	69	7.48e-6	PROSPERO
internal_repeat_1	81	153	7.48e-6	PROSPERO
low complexity region	168	183	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in 4930430A15Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:4930430A15Rik	APN	2	111220762	missense	probably damaging	0.98
IGL01403:4930430A15Rik	APN	2	111229170	unclassified	probably benign
IGL01431:4930430A15Rik	APN	2	111225395	unclassified	probably benign
IGL01601:4930430A15Rik	APN	2	111193478	missense	unknown
IGL01649:4930430A15Rik	APN	2	111214576	splice site	probably benign
IGL02355:4930430A15Rik	APN	2	111211651	splice site	probably benign
IGL02362:4930430A15Rik	APN	2	111211651	splice site	probably benign
IGL02485:4930430A15Rik	APN	2	111228325	missense	probably damaging	0.97
IGL02620:4930430A15Rik	APN	2	111211625	missense	probably benign	0.00
IGL03156:4930430A15Rik	APN	2	111200412	missense	possibly damaging	0.90
IGL02980:4930430A15Rik	UTSW	2	111164473	missense	unknown
R0577:4930430A15Rik	UTSW	2	111194349	missense	probably benign	0.27
R0638:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R0645:4930430A15Rik	UTSW	2	111214583	critical splice donor site	probably null
R0671:4930430A15Rik	UTSW	2	111204137	missense	possibly damaging	0.93
R0829:4930430A15Rik	UTSW	2	111198105	missense	possibly damaging	0.92
R1464:4930430A15Rik	UTSW	2	111225403	critical splice donor site	probably null
R1464:4930430A15Rik	UTSW	2	111225403	critical splice donor site	probably null
R1486:4930430A15Rik	UTSW	2	111200358	missense	possibly damaging	0.84
R1509:4930430A15Rik	UTSW	2	111218627	missense	probably benign
R1672:4930430A15Rik	UTSW	2	111220774	missense	probably benign	0.00
R2073:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2074:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2075:4930430A15Rik	UTSW	2	111200418	missense	probably damaging	0.96
R2899:4930430A15Rik	UTSW	2	111220670	splice site	probably benign
R2965:4930430A15Rik	UTSW	2	111204019	missense	possibly damaging	0.61
R3110:4930430A15Rik	UTSW	2	111228054	missense	probably damaging	1.00
R3112:4930430A15Rik	UTSW	2	111228054	missense	probably damaging	1.00
R4489:4930430A15Rik	UTSW	2	111220702	missense	probably benign	0.31
R4821:4930430A15Rik	UTSW	2	111204145	critical splice acceptor site	probably null
R4925:4930430A15Rik	UTSW	2	111218616	missense	probably benign	0.41
R5045:4930430A15Rik	UTSW	2	111193459	missense	unknown
R5057:4930430A15Rik	UTSW	2	111225421	missense	probably benign	0.12
R5128:4930430A15Rik	UTSW	2	111164329	nonsense	probably null
R5250:4930430A15Rik	UTSW	2	111228077	missense	possibly damaging	0.87
R5333:4930430A15Rik	UTSW	2	111194337	missense	possibly damaging	0.92
R5376:4930430A15Rik	UTSW	2	111215599	missense	probably benign	0.44
R5677:4930430A15Rik	UTSW	2	111211565	missense	probably benign
R5722:4930430A15Rik	UTSW	2	111204123	missense	probably benign
R5735:4930430A15Rik	UTSW	2	111225492	nonsense	probably null
R6170:4930430A15Rik	UTSW	2	111227948	missense	probably benign	0.03
R6366:4930430A15Rik	UTSW	2	111169592	critical splice donor site	probably null
R6496:4930430A15Rik	UTSW	2	111164472	missense	unknown
R6983:4930430A15Rik	UTSW	2	111228250	critical splice donor site	probably null
R7371:4930430A15Rik	UTSW	2	111193481	missense	unknown
R7958:4930430A15Rik	UTSW	2	111170325	missense	unknown
R8421:4930430A15Rik	UTSW	2	111218610	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGTTCAAATACCCTGGATCAG -3'
(R):5'- GAGTCCTTCCATTAACATTACACTGC -3'

Sequencing Primer
(F):5'- TACCCTGGATCAGATCTCAGG -3'
(R):5'- ACTATGCCTGAATGATGCTTTTC -3'

Posted On

2018-07-23