Incidental Mutation 'R6654:Exd1'
ID526546
Institutional Source Beutler Lab
Gene Symbol Exd1
Ensembl Gene ENSMUSG00000048647
Gene Nameexonuclease 3'-5' domain containing 1
SynonymsExdl1, 4932702D22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119516505-119547627 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 119524717 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060009] [ENSMUST00000060009] [ENSMUST00000171024] [ENSMUST00000171024]
Predicted Effect probably null
Transcript: ENSMUST00000060009
SMART Domains Protein: ENSMUSP00000054980
Gene: ENSMUSG00000048647

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060009
SMART Domains Protein: ENSMUSP00000054980
Gene: ENSMUSG00000048647

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171024
SMART Domains Protein: ENSMUSP00000126713
Gene: ENSMUSG00000048647

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171024
SMART Domains Protein: ENSMUSP00000126713
Gene: ENSMUSG00000048647

DomainStartEndE-ValueType
low complexity region 73 84 N/A INTRINSIC
35EXOc 134 325 2.29e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are fertile and viable, but exhibit defective biogenesis of antisense piRNAs and activation of transposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Exd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Exd1 APN 2 119530079 splice site probably benign
IGL02032:Exd1 APN 2 119533467 missense probably damaging 1.00
IGL02040:Exd1 APN 2 119540065 missense possibly damaging 0.79
IGL02831:Exd1 APN 2 119528754 missense probably damaging 1.00
IGL03008:Exd1 APN 2 119520381 missense probably benign 0.01
R0350:Exd1 UTSW 2 119523566 missense possibly damaging 0.64
R1423:Exd1 UTSW 2 119540013 splice site probably benign
R1466:Exd1 UTSW 2 119520734 splice site probably benign
R1524:Exd1 UTSW 2 119524674 missense probably damaging 0.98
R2011:Exd1 UTSW 2 119528663 intron probably benign
R2026:Exd1 UTSW 2 119520305 missense probably benign
R4711:Exd1 UTSW 2 119538751 missense possibly damaging 0.91
R4827:Exd1 UTSW 2 119520326 missense probably benign
R4828:Exd1 UTSW 2 119520326 missense probably benign
R4829:Exd1 UTSW 2 119520326 missense probably benign
R4830:Exd1 UTSW 2 119520326 missense probably benign
R5799:Exd1 UTSW 2 119538781 missense probably benign 0.01
R6570:Exd1 UTSW 2 119520173 missense probably benign
R6907:Exd1 UTSW 2 119533476 missense probably damaging 1.00
R7325:Exd1 UTSW 2 119520139 missense probably benign 0.28
R7684:Exd1 UTSW 2 119520203 missense probably damaging 1.00
R7921:Exd1 UTSW 2 119530099 missense probably damaging 0.99
R8029:Exd1 UTSW 2 119528723 missense probably damaging 1.00
R8428:Exd1 UTSW 2 119538867 missense possibly damaging 0.80
R8516:Exd1 UTSW 2 119520073 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAACACACCTGAAATGTAGTGACAC -3'
(R):5'- ACCTATAGCATCCATGGGATAATG -3'

Sequencing Primer
(F):5'- CCTGAAATGTAGTGACACACCTTTC -3'
(R):5'- CCCACGTCTTAGATAATGATCCATGG -3'
Posted On2018-07-23