Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:Kif16b'

526547

Institutional Source

Beutler Lab

Gene Symbol

Kif16b

Ensembl Gene

ENSMUSG00000038844

Gene Name

kinesin family member 16B

Synonyms

8430434E15Rik, N-3 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142617474-142901531 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 142701277 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]

Predicted Effect

probably benign
Transcript: ENSMUST00000043589

SMART Domains

Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844

Domain	Start	End	E-Value	Type
KISc	1	366	4.87e-173	SMART
FHA	477	529	1.43e-1	SMART
coiled coil region	597	809	N/A	INTRINSIC
coiled coil region	835	858	N/A	INTRINSIC
coiled coil region	941	1022	N/A	INTRINSIC
PX	1179	1281	1.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211861

Predicted Effect

unknown
Transcript: ENSMUST00000212106
AA Change: D33G

Predicted Effect

probably benign
Transcript: ENSMUST00000230763

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Kif16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kif16b	APN	2	142848035	nonsense	probably null
IGL00499:Kif16b	APN	2	142857324	missense	probably damaging	1.00
IGL00913:Kif16b	APN	2	142704007	nonsense	probably null
IGL00971:Kif16b	APN	2	142711744	missense	probably benign	0.01
IGL01712:Kif16b	APN	2	142648471	missense	probably damaging	1.00
IGL01965:Kif16b	APN	2	142848405	missense	probably damaging	1.00
IGL02428:Kif16b	APN	2	142672360	missense	possibly damaging	0.88
IGL02576:Kif16b	APN	2	142862545	splice site	probably benign
IGL02884:Kif16b	APN	2	142702614	splice site	probably benign
IGL03065:Kif16b	APN	2	142619913	missense	probably damaging	1.00
IGL03103:Kif16b	APN	2	142862488	missense	probably damaging	1.00
IGL03403:Kif16b	APN	2	142711869	missense	probably damaging	1.00
IGL02835:Kif16b	UTSW	2	142712213	missense	probably benign	0.00
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0081:Kif16b	UTSW	2	142707426	splice site	probably benign
R0123:Kif16b	UTSW	2	142672375	missense	probably benign
R0134:Kif16b	UTSW	2	142672375	missense	probably benign
R0388:Kif16b	UTSW	2	142740937	missense	probably damaging	1.00
R0396:Kif16b	UTSW	2	142853659	missense	probably damaging	1.00
R0502:Kif16b	UTSW	2	142712155	missense	probably benign	0.00
R1027:Kif16b	UTSW	2	142854538	splice site	probably benign
R1674:Kif16b	UTSW	2	142712953	nonsense	probably null
R1752:Kif16b	UTSW	2	142690666	missense	probably benign	0.01
R2154:Kif16b	UTSW	2	142690580	missense	probably damaging	1.00
R2262:Kif16b	UTSW	2	142740917	missense	probably damaging	1.00
R2401:Kif16b	UTSW	2	142756122	missense	probably benign	0.04
R3951:Kif16b	UTSW	2	142707359	missense	probably benign	0.01
R4161:Kif16b	UTSW	2	142707404	missense	probably benign	0.00
R4697:Kif16b	UTSW	2	142690694	missense	probably benign	0.09
R4747:Kif16b	UTSW	2	142857426	missense	probably damaging	1.00
R4808:Kif16b	UTSW	2	142857358	missense	probably damaging	1.00
R4878:Kif16b	UTSW	2	142848003	missense	probably damaging	1.00
R5068:Kif16b	UTSW	2	142711707	missense	probably benign
R5120:Kif16b	UTSW	2	142848339	missense	probably damaging	1.00
R5358:Kif16b	UTSW	2	142740969	missense	probably damaging	1.00
R5821:Kif16b	UTSW	2	142702666	missense	probably damaging	1.00
R5833:Kif16b	UTSW	2	142707367	missense	probably benign
R5882:Kif16b	UTSW	2	142707258	critical splice donor site	probably null
R5974:Kif16b	UTSW	2	142857381	missense	probably damaging	1.00
R6043:Kif16b	UTSW	2	142711900	missense	probably damaging	1.00
R6230:Kif16b	UTSW	2	142849912	missense	probably damaging	1.00
R6373:Kif16b	UTSW	2	142699698	missense	possibly damaging	0.91
R6472:Kif16b	UTSW	2	142699948	intron	probably benign
R6622:Kif16b	UTSW	2	142712442	missense	probably benign	0.01
R6912:Kif16b	UTSW	2	142700099	intron	probably benign
R7003:Kif16b	UTSW	2	142758829	missense	possibly damaging	0.95
R7265:Kif16b	UTSW	2	142714730	missense	probably damaging	1.00
R7307:Kif16b	UTSW	2	142712931	missense	probably benign	0.00
R7376:Kif16b	UTSW	2	142711872	missense	probably damaging	0.99
R7381:Kif16b	UTSW	2	142857423	missense	probably damaging	1.00
R7558:Kif16b	UTSW	2	142758826	missense	probably damaging	1.00
R7681:Kif16b	UTSW	2	142756126	missense	probably damaging	1.00
R7896:Kif16b	UTSW	2	142834075	critical splice donor site	probably null
R7956:Kif16b	UTSW	2	142862470	missense	probably benign	0.00
R8053:Kif16b	UTSW	2	142853714	missense	probably damaging	1.00
R8056:Kif16b	UTSW	2	142712842	missense	probably damaging	1.00
R8139:Kif16b	UTSW	2	142901365	missense	probably benign	0.00
R8182:Kif16b	UTSW	2	142712899	missense	possibly damaging	0.90
R8224:Kif16b	UTSW	2	142834088	missense	probably benign	0.03
R8357:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8359:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8360:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8369:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8385:Kif16b	UTSW	2	142712338	missense	probably benign	0.09
R8457:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
X0058:Kif16b	UTSW	2	142758861	missense	probably damaging	1.00
Z1177:Kif16b	UTSW	2	142711824	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGCCAGAATTCTCAGGGTAAC -3'
(R):5'- GTTCCATAAATGAATCAACCCTCTG -3'

Sequencing Primer
(F):5'- TCTCAGGGTAACAAAATTTGTCAC -3'
(R):5'- TCAAAACCAATGACTTAGTCCTTC -3'

Posted On

2018-07-23