Incidental Mutation 'R6654:Gm15922'
ID526553
Institutional Source Beutler Lab
Gene Symbol Gm15922
Ensembl Gene ENSMUSG00000081665
Gene Namepredicted gene 15922
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6654 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3733021-3739861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3735929 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 560 (S560T)
Ref Sequence ENSEMBL: ENSMUSP00000145713 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000118068
AA Change: S560T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Gm15922
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Gm15922 UTSW 7 3739640 missense possibly damaging 0.82
R3902:Gm15922 UTSW 7 3737277 missense probably damaging 0.99
R4246:Gm15922 UTSW 7 3737349 missense probably damaging 1.00
R5125:Gm15922 UTSW 7 3739397 nonsense probably null
R5178:Gm15922 UTSW 7 3739397 nonsense probably null
R5388:Gm15922 UTSW 7 3738857 missense possibly damaging 0.49
R5471:Gm15922 UTSW 7 3735515 missense probably benign 0.02
R5985:Gm15922 UTSW 7 3737317 missense probably damaging 1.00
R6248:Gm15922 UTSW 7 3736338 missense probably benign
R6360:Gm15922 UTSW 7 3736504 missense probably damaging 1.00
R6451:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6453:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6454:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6455:Gm15922 UTSW 7 3738931 missense probably benign 0.00
R6594:Gm15922 UTSW 7 3736499 nonsense probably null
R6813:Gm15922 UTSW 7 3736003 missense probably benign 0.03
R6972:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6975:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7069:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7072:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7188:Gm15922 UTSW 7 3738829 missense probably damaging 0.99
R7304:Gm15922 UTSW 7 3737494 missense probably damaging 1.00
R7329:Gm15922 UTSW 7 3739876 start gained probably benign
R7404:Gm15922 UTSW 7 3739345 missense probably damaging 1.00
R7454:Gm15922 UTSW 7 3735510 missense probably benign 0.03
R7493:Gm15922 UTSW 7 3739024 missense not run
R7655:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7656:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7953:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7956:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7957:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8037:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8038:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8043:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8096:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8117:Gm15922 UTSW 7 3737076 missense probably damaging 1.00
R8128:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8134:Gm15922 UTSW 7 3735839 missense probably damaging 0.99
R8142:Gm15922 UTSW 7 3736843 missense possibly damaging 0.88
R8311:Gm15922 UTSW 7 3736483 missense probably benign 0.42
R8511:Gm15922 UTSW 7 3739348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACCTGAGACTGTGAGC -3'
(R):5'- GAGACAGAGACCCACTTTCTC -3'

Sequencing Primer
(F):5'- TACCTGAGACTGTGAGCTCCAC -3'
(R):5'- CATGTGTGATTGGAGCTCAGAAC -3'
Posted On2018-07-23