Incidental Mutation 'R6654:Zfp974'
ID 526554
Institutional Source Beutler Lab
Gene Symbol Zfp974
Ensembl Gene ENSMUSG00000070709
Gene Name zinc finger protein 974
Synonyms 1700049G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6654 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 27907392-27929460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27926403 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000115940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098639] [ENSMUST00000129341]
AlphaFold Q3UVF6
Predicted Effect probably benign
Transcript: ENSMUST00000098639
SMART Domains Protein: ENSMUSP00000096238
Gene: ENSMUSG00000070709

DomainStartEndE-ValueType
ZnF_C2H2 99 121 8.81e-2 SMART
ZnF_C2H2 127 149 1.82e-3 SMART
ZnF_C2H2 155 177 3.11e-2 SMART
ZnF_C2H2 201 223 2.15e-5 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 1.47e-3 SMART
ZnF_C2H2 285 307 1.79e-2 SMART
ZnF_C2H2 313 335 2.24e-3 SMART
ZnF_C2H2 341 363 9.73e-4 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
ZnF_C2H2 397 419 6.42e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.28e-3 SMART
ZnF_C2H2 481 503 1.26e-2 SMART
ZnF_C2H2 509 531 1.38e-3 SMART
ZnF_C2H2 537 559 3.83e-2 SMART
ZnF_C2H2 565 587 1.95e-3 SMART
ZnF_C2H2 593 615 4.61e-5 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 1.03e-2 SMART
ZnF_C2H2 677 699 5.5e-3 SMART
ZnF_C2H2 705 727 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129341
AA Change: V14A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115940
Gene: ENSMUSG00000070709
AA Change: V14A

DomainStartEndE-ValueType
KRAB 14 75 7.5e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181644
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Other mutations in Zfp974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Zfp974 APN 7 27910890 missense possibly damaging 0.83
IGL01805:Zfp974 APN 7 27912264 splice site probably benign
IGL02313:Zfp974 APN 7 27912253 missense possibly damaging 0.53
IGL02449:Zfp974 APN 7 27911727 missense probably benign
R0362:Zfp974 UTSW 7 27927394 splice site probably benign
R0372:Zfp974 UTSW 7 27920695 critical splice donor site probably null
R0379:Zfp974 UTSW 7 27910932 missense probably damaging 0.98
R0699:Zfp974 UTSW 7 27911991 missense possibly damaging 0.56
R0791:Zfp974 UTSW 7 27910085 nonsense probably null
R1411:Zfp974 UTSW 7 27911209 missense probably benign 0.00
R1567:Zfp974 UTSW 7 27910723 missense probably damaging 0.99
R1747:Zfp974 UTSW 7 27911081 missense possibly damaging 0.61
R1837:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1838:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1839:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R2311:Zfp974 UTSW 7 27910441 missense possibly damaging 0.73
R4006:Zfp974 UTSW 7 27912252 missense possibly damaging 0.86
R4303:Zfp974 UTSW 7 27910232 missense possibly damaging 0.85
R4541:Zfp974 UTSW 7 27926404 missense probably damaging 0.99
R4771:Zfp974 UTSW 7 27926308 missense probably damaging 0.96
R4889:Zfp974 UTSW 7 27910819 missense possibly damaging 0.86
R5332:Zfp974 UTSW 7 27926290 missense probably benign 0.01
R5537:Zfp974 UTSW 7 27912246 critical splice acceptor site probably benign
R5906:Zfp974 UTSW 7 27910805 missense possibly damaging 0.72
R5908:Zfp974 UTSW 7 27910957 missense probably benign 0.01
R6419:Zfp974 UTSW 7 27911515 missense possibly damaging 0.72
R6731:Zfp974 UTSW 7 27911649 missense possibly damaging 0.93
R7162:Zfp974 UTSW 7 27911519 missense possibly damaging 0.71
R7316:Zfp974 UTSW 7 27910438 missense possibly damaging 0.93
R7484:Zfp974 UTSW 7 27912134 missense possibly damaging 0.72
R7663:Zfp974 UTSW 7 27911685 missense possibly damaging 0.74
R7664:Zfp974 UTSW 7 27910712 missense possibly damaging 0.86
R8052:Zfp974 UTSW 7 27911272 missense probably damaging 1.00
R8698:Zfp974 UTSW 7 27910936 missense possibly damaging 0.90
R8700:Zfp974 UTSW 7 27910047 missense possibly damaging 0.86
R8938:Zfp974 UTSW 7 27910886 missense possibly damaging 0.74
R8972:Zfp974 UTSW 7 27911164 missense probably benign 0.06
R9212:Zfp974 UTSW 7 27910627 missense possibly damaging 0.86
R9236:Zfp974 UTSW 7 27910917 missense possibly damaging 0.51
R9335:Zfp974 UTSW 7 27912051 missense probably benign 0.02
R9436:Zfp974 UTSW 7 27911669 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCAGCTACCACTGGAAAGATGG -3'
(R):5'- AGAGGCACAGGTATTGGCTATG -3'

Sequencing Primer
(F):5'- CCTTTAATTCAGAGTGAGGAAAGCCC -3'
(R):5'- CTATGTAGGTGGGCACAGTC -3'
Posted On 2018-07-23