Incidental Mutation 'R6654:Armc6'
ID526557
Institutional Source Beutler Lab
Gene Symbol Armc6
Ensembl Gene ENSMUSG00000002343
Gene Namearmadillo repeat containing 6
Synonyms2410153K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70220172-70234466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70231375 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 9 (E9G)
Ref Sequence ENSEMBL: ENSMUSP00000116811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019679] [ENSMUST00000093458] [ENSMUST00000130319] [ENSMUST00000131489] [ENSMUST00000145078] [ENSMUST00000164403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019679
AA Change: E9G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019679
Gene: ENSMUSG00000002343
AA Change: E9G

DomainStartEndE-ValueType
Blast:UTG 14 77 2e-26 BLAST
ARM 140 182 8.74e1 SMART
ARM 184 226 3.64e-7 SMART
ARM 237 280 6.01e0 SMART
ARM 281 323 1.13e-3 SMART
ARM 324 366 8.3e-2 SMART
ARM 368 410 1.06e1 SMART
Blast:ARM 438 468 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093458
SMART Domains Protein: ENSMUSP00000091167
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130319
AA Change: E9G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116811
Gene: ENSMUSG00000002343
AA Change: E9G

DomainStartEndE-ValueType
Blast:UTG 14 78 8e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131489
SMART Domains Protein: ENSMUSP00000114833
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136758
Predicted Effect probably benign
Transcript: ENSMUST00000145078
SMART Domains Protein: ENSMUSP00000114403
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164403
SMART Domains Protein: ENSMUSP00000128029
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene's protein product has not been determined. A related protein in mouse suggests that this protein has a conserved function. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Armc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Armc6 APN 8 70225220 nonsense probably null
IGL03090:Armc6 APN 8 70231354 missense probably benign 0.00
R1449:Armc6 UTSW 8 70225293 missense probably benign 0.01
R1557:Armc6 UTSW 8 70225448 missense possibly damaging 0.75
R1689:Armc6 UTSW 8 70229537 missense probably benign
R3054:Armc6 UTSW 8 70225149 missense probably benign 0.12
R4368:Armc6 UTSW 8 70225293 missense probably benign 0.01
R7726:Armc6 UTSW 8 70222598 missense probably damaging 1.00
X0022:Armc6 UTSW 8 70222542 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACAGCACGTCACTACTGTG -3'
(R):5'- AGTGCCCTAAGTGCCCATTTC -3'

Sequencing Primer
(F):5'- ACAGCACGTCACTACTGTGTTAGG -3'
(R):5'- TGGTAGCAAGGCTTTACCCACAG -3'
Posted On2018-07-23