Incidental Mutation 'R6654:Rpgrip1l'
ID526558
Institutional Source Beutler Lab
Gene Symbol Rpgrip1l
Ensembl Gene ENSMUSG00000033282
Gene NameRpgrip1-like
SynonymsNphp8, fantom, Ftm, 1700047E16Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location91217030-91313262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91220205 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1256 (E1256G)
Ref Sequence ENSEMBL: ENSMUSP00000042702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]
Predicted Effect probably benign
Transcript: ENSMUST00000047783
AA Change: E1256G

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: E1256G

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
coiled coil region 196 268 N/A INTRINSIC
coiled coil region 299 371 N/A INTRINSIC
coiled coil region 395 454 N/A INTRINSIC
coiled coil region 520 556 N/A INTRINSIC
Pfam:C2-C2_1 597 738 5.8e-61 PFAM
low complexity region 769 778 N/A INTRINSIC
C2 791 896 1.06e-5 SMART
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1057 1080 N/A INTRINSIC
Blast:C2 1098 1223 3e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000139113
SMART Domains Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

DomainStartEndE-ValueType
coiled coil region 56 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211546
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Rpgrip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rpgrip1l APN 8 91263574 missense possibly damaging 0.52
IGL00932:Rpgrip1l APN 8 91275637 missense probably benign 0.33
IGL01113:Rpgrip1l APN 8 91260739 intron probably benign
IGL01151:Rpgrip1l APN 8 91275149 missense probably damaging 1.00
IGL01321:Rpgrip1l APN 8 91260873 nonsense probably null
IGL01384:Rpgrip1l APN 8 91273640 missense probably benign 0.00
IGL01634:Rpgrip1l APN 8 91252543 missense probably benign
IGL01634:Rpgrip1l APN 8 91252544 missense probably benign 0.25
IGL01781:Rpgrip1l APN 8 91270218 missense probably benign 0.16
IGL01784:Rpgrip1l APN 8 91270461 missense possibly damaging 0.56
IGL02034:Rpgrip1l APN 8 91251148 critical splice donor site probably null
IGL02250:Rpgrip1l APN 8 91232861 missense probably benign 0.00
IGL02285:Rpgrip1l APN 8 91232907 missense possibly damaging 0.92
IGL02634:Rpgrip1l APN 8 91225344 splice site probably benign
IGL02736:Rpgrip1l APN 8 91263591 missense possibly damaging 0.91
IGL02825:Rpgrip1l APN 8 91304805 missense probably damaging 0.99
IGL02962:Rpgrip1l APN 8 91270362 missense possibly damaging 0.95
IGL03031:Rpgrip1l APN 8 91260783 missense probably damaging 1.00
IGL03184:Rpgrip1l APN 8 91300809 missense probably damaging 1.00
P0005:Rpgrip1l UTSW 8 91299225 splice site probably benign
R0118:Rpgrip1l UTSW 8 91270122 missense probably damaging 1.00
R0490:Rpgrip1l UTSW 8 91299845 splice site probably benign
R0599:Rpgrip1l UTSW 8 91305000 missense probably damaging 1.00
R1514:Rpgrip1l UTSW 8 91260750 missense probably damaging 1.00
R1648:Rpgrip1l UTSW 8 91252889 missense probably damaging 1.00
R1914:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R1915:Rpgrip1l UTSW 8 91232924 missense probably benign 0.13
R2093:Rpgrip1l UTSW 8 91270132 missense possibly damaging 0.87
R2225:Rpgrip1l UTSW 8 91221467 missense probably benign 0.45
R2504:Rpgrip1l UTSW 8 91280716 critical splice donor site probably null
R3859:Rpgrip1l UTSW 8 91263658 missense probably benign 0.00
R4118:Rpgrip1l UTSW 8 91252907 missense probably benign
R4801:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4802:Rpgrip1l UTSW 8 91270177 missense probably damaging 1.00
R4921:Rpgrip1l UTSW 8 91261009 missense probably benign 0.05
R4976:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5092:Rpgrip1l UTSW 8 91221384 nonsense probably null
R5099:Rpgrip1l UTSW 8 91248722 missense probably benign 0.20
R5119:Rpgrip1l UTSW 8 91280816 missense probably damaging 1.00
R5141:Rpgrip1l UTSW 8 91260918 missense probably benign 0.29
R5793:Rpgrip1l UTSW 8 91260772 missense probably benign 0.06
R5847:Rpgrip1l UTSW 8 91304985 missense probably damaging 1.00
R5871:Rpgrip1l UTSW 8 91221386 missense possibly damaging 0.89
R5916:Rpgrip1l UTSW 8 91252913 missense possibly damaging 0.93
R6619:Rpgrip1l UTSW 8 91232871 missense possibly damaging 0.69
R6956:Rpgrip1l UTSW 8 91286313 splice site probably null
R6984:Rpgrip1l UTSW 8 91260798 missense probably benign 0.03
R7064:Rpgrip1l UTSW 8 91263520 nonsense probably null
R7145:Rpgrip1l UTSW 8 91232806 critical splice donor site probably null
R7243:Rpgrip1l UTSW 8 91270123 missense probably benign 0.00
R7673:Rpgrip1l UTSW 8 91300787 missense possibly damaging 0.89
R7796:Rpgrip1l UTSW 8 91270237 missense probably damaging 1.00
Z1088:Rpgrip1l UTSW 8 91220179 makesense probably null
Z1088:Rpgrip1l UTSW 8 91260975 missense possibly damaging 0.96
Z1088:Rpgrip1l UTSW 8 91270120 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAAGTCTAAACCCAGGCGC -3'
(R):5'- CACTGAGTGTACCATACCTTTGTAG -3'

Sequencing Primer
(F):5'- TAAACCCAGGCGCTCCCTC -3'
(R):5'- TGTAGTACTCCACAGTGATAGCC -3'
Posted On2018-07-23