Incidental Mutation 'R6654:Sorl1'
ID526560
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41980645 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1903 (D1903G)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: D1903G

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D1903G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148800
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAGGAAACTGGCTGTGGG -3'
(R):5'- GCTCAGCATTCTAAAGGCAGAG -3'

Sequencing Primer
(F):5'- ACTGGCTGTGGGAACTTACAC -3'
(R):5'- GGGTACTTTACAAGCACTTCCAAGG -3'
Posted On2018-07-23