Mutagenetix > Incidental Mutation

Incidental Mutation 'R6654:Sorl1'

526560

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

Sorla, mSorLA, LR11, 2900010L19Rik

MMRRC Submission

044775-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.319) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41876016-42035593 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41891941 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1903 (D1903G)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060989
AA Change: D1903G

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D1903G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148800

Meta Mutation Damage Score

0.1608

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1b1	C	T	6: 34,286,939 (GRCm39)	V206M	possibly damaging	Het
Armc6	T	C	8: 70,684,025 (GRCm39)	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,641,818 (GRCm39)	254	probably null	Het
Ddc	A	T	11: 11,830,452 (GRCm39)	I64N	probably damaging	Het
Exd1	T	A	2: 119,355,198 (GRCm39)		probably null	Het
Gm4847	C	A	1: 166,457,956 (GRCm39)	G466C	probably damaging	Het
Gm5431	T	C	11: 48,785,427 (GRCm39)	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,116,381 (GRCm39)	F197L	probably damaging	Het
Irs2	A	G	8: 11,056,486 (GRCm39)	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,543,197 (GRCm39)		probably benign	Het
Krtap12-1	T	C	10: 77,556,537 (GRCm39)		probably benign	Het
Ktn1	G	A	14: 47,927,457 (GRCm39)	S537N	probably damaging	Het
Med12l	G	T	3: 59,169,713 (GRCm39)	G1626W	probably damaging	Het
Mfng	T	A	15: 78,643,539 (GRCm39)	T223S	probably damaging	Het
Msh3	T	C	13: 92,481,550 (GRCm39)	T321A	probably benign	Het
Myo7b	T	C	18: 32,123,322 (GRCm39)	I672V	possibly damaging	Het
Nbas	C	T	12: 13,533,875 (GRCm39)	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,752,523 (GRCm39)	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,357,516 (GRCm39)	V310E	probably damaging	Het
Or4p21	T	G	2: 88,277,016 (GRCm39)	T89P	possibly damaging	Het
Or5aq6	A	G	2: 86,923,394 (GRCm39)	S116P	probably benign	Het
P2ry12	A	G	3: 59,125,441 (GRCm39)	L78P	probably damaging	Het
Pira1	A	T	7: 3,738,928 (GRCm39)	S560T	probably benign	Het
Pkd1l3	T	G	8: 110,350,915 (GRCm39)	S587A	probably benign	Het
Potefam1	T	A	2: 111,002,229 (GRCm39)	M154L	unknown	Het
Prkacb	A	G	3: 146,456,298 (GRCm39)	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,946,833 (GRCm39)	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,788,988 (GRCm39)	Q611R	probably benign	Het
Tmem39b	A	T	4: 129,580,619 (GRCm39)	V291D	probably damaging	Het
Unc79	A	C	12: 103,045,307 (GRCm39)	K685Q	probably damaging	Het
Unc79	A	T	12: 103,045,308 (GRCm39)	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,778,032 (GRCm39)	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,822,450 (GRCm39)	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,684,640 (GRCm39)	C35*	probably null	Het
Zfp974	A	G	7: 27,625,828 (GRCm39)	V14A	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41,885,390 (GRCm39)	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	41,935,774 (GRCm39)	splice site	probably benign
IGL01545:Sorl1	APN	9	41,955,252 (GRCm39)	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	41,968,565 (GRCm39)	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	41,912,788 (GRCm39)	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	41,915,330 (GRCm39)	missense	probably benign
IGL02215:Sorl1	APN	9	41,929,478 (GRCm39)	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	41,952,986 (GRCm39)	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	41,957,857 (GRCm39)	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	41,975,070 (GRCm39)	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	41,948,355 (GRCm39)	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	41,952,349 (GRCm39)	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	41,968,621 (GRCm39)	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41,902,722 (GRCm39)	missense	probably benign
IGL03288:Sorl1	APN	9	41,944,858 (GRCm39)	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41,879,918 (GRCm39)	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	41,944,873 (GRCm39)	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	41,993,250 (GRCm39)	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	41,943,205 (GRCm39)	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	41,915,384 (GRCm39)	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41,902,667 (GRCm39)	missense	probably null	0.00
R0512:Sorl1	UTSW	9	41,979,128 (GRCm39)	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41,895,802 (GRCm39)	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	41,955,196 (GRCm39)	splice site	probably benign
R0831:Sorl1	UTSW	9	41,982,365 (GRCm39)	splice site	probably benign
R0924:Sorl1	UTSW	9	41,919,470 (GRCm39)	splice site	probably benign
R1013:Sorl1	UTSW	9	41,913,855 (GRCm39)	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41,902,752 (GRCm39)	missense	probably benign
R1077:Sorl1	UTSW	9	41,925,786 (GRCm39)	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	41,943,092 (GRCm39)	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	41,911,708 (GRCm39)	splice site	probably null
R1498:Sorl1	UTSW	9	41,952,369 (GRCm39)	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41,885,296 (GRCm39)	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41,907,538 (GRCm39)	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42,001,261 (GRCm39)	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41,902,778 (GRCm39)	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41,881,021 (GRCm39)	nonsense	probably null
R1912:Sorl1	UTSW	9	41,993,246 (GRCm39)	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	41,957,920 (GRCm39)	missense	probably benign
R2071:Sorl1	UTSW	9	41,890,753 (GRCm39)	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41,895,788 (GRCm39)	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41,892,007 (GRCm39)	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	41,948,366 (GRCm39)	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41,881,077 (GRCm39)	missense	probably benign
R3815:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	41,975,345 (GRCm39)	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	41,915,401 (GRCm39)	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41,900,764 (GRCm39)	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	41,946,744 (GRCm39)	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	41,915,288 (GRCm39)	nonsense	probably null
R4610:Sorl1	UTSW	9	41,943,210 (GRCm39)	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	41,915,347 (GRCm39)	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41,895,804 (GRCm39)	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41,903,617 (GRCm39)	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	41,975,048 (GRCm39)	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	41,952,935 (GRCm39)	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	41,925,746 (GRCm39)	splice site	probably null
R4976:Sorl1	UTSW	9	41,894,299 (GRCm39)	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41,902,638 (GRCm39)	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R5070:Sorl1	UTSW	9	41,943,114 (GRCm39)	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41,887,673 (GRCm39)	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	41,944,879 (GRCm39)	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42,017,812 (GRCm39)	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	41,942,198 (GRCm39)	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41,890,686 (GRCm39)	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	41,968,580 (GRCm39)	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	41,913,932 (GRCm39)	nonsense	probably null
R5518:Sorl1	UTSW	9	41,948,508 (GRCm39)	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41,902,921 (GRCm39)	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42,003,669 (GRCm39)	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41,894,330 (GRCm39)	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41,881,038 (GRCm39)	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41,887,703 (GRCm39)	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	41,982,530 (GRCm39)	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	41,912,899 (GRCm39)	missense	possibly damaging	0.81
R6691:Sorl1	UTSW	9	41,913,863 (GRCm39)	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	41,982,497 (GRCm39)	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	41,982,497 (GRCm39)	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42,003,748 (GRCm39)	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42,010,559 (GRCm39)	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	41,935,694 (GRCm39)	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	41,933,688 (GRCm39)	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	41,944,922 (GRCm39)	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41,881,047 (GRCm39)	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	41,942,279 (GRCm39)	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	41,913,930 (GRCm39)	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42,035,375 (GRCm39)	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	41,948,499 (GRCm39)	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	41,975,006 (GRCm39)	splice site	probably null
R7537:Sorl1	UTSW	9	41,891,984 (GRCm39)	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41,888,878 (GRCm39)	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42,003,630 (GRCm39)	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41,895,822 (GRCm39)	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	41,955,205 (GRCm39)	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42,001,257 (GRCm39)	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41,900,655 (GRCm39)	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41,902,697 (GRCm39)	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41,888,857 (GRCm39)	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	41,952,857 (GRCm39)	splice site	probably null
R8261:Sorl1	UTSW	9	41,925,777 (GRCm39)	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	41,942,294 (GRCm39)	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	41,929,456 (GRCm39)	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41,903,041 (GRCm39)	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41,885,370 (GRCm39)	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	41,933,722 (GRCm39)	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	41,911,567 (GRCm39)	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	41,957,848 (GRCm39)	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	41,982,491 (GRCm39)	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	41,975,050 (GRCm39)	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41,885,420 (GRCm39)	nonsense	probably null
R9278:Sorl1	UTSW	9	41,957,857 (GRCm39)	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	41,952,927 (GRCm39)	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41,900,739 (GRCm39)	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	41,979,229 (GRCm39)	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	41,912,814 (GRCm39)	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42,035,384 (GRCm39)	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	41,933,631 (GRCm39)	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9563:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	41,957,893 (GRCm39)	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	41,993,105 (GRCm39)	nonsense	probably null
R9634:Sorl1	UTSW	9	41,907,590 (GRCm39)	missense	probably benign
R9671:Sorl1	UTSW	9	41,943,077 (GRCm39)	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42,003,766 (GRCm39)	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42,035,244 (GRCm39)	missense	probably benign	0.03
Z1176:Sorl1	UTSW	9	42,010,499 (GRCm39)	missense	possibly damaging	0.64
Z1177:Sorl1	UTSW	9	42,017,837 (GRCm39)	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	41,902,934 (GRCm39)	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42,035,208 (GRCm39)	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	41,952,892 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTAGGAAACTGGCTGTGGG -3'
(R):5'- GCTCAGCATTCTAAAGGCAGAG -3'

Sequencing Primer
(F):5'- ACTGGCTGTGGGAACTTACAC -3'
(R):5'- GGGTACTTTACAAGCACTTCCAAGG -3'

Posted On

2018-07-23