Incidental Mutation 'R6654:Rsph4a'
ID526562
Institutional Source Beutler Lab
Gene Symbol Rsph4a
Ensembl Gene ENSMUSG00000039552
Gene Nameradial spoke head 4 homolog A (Chlamydomonas)
SynonymsRshl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location33905111-33916021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33912992 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 611 (Q611R)
Ref Sequence ENSEMBL: ENSMUSP00000131647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169670]
Predicted Effect probably benign
Transcript: ENSMUST00000169670
AA Change: Q611R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131647
Gene: ENSMUSG00000039552
AA Change: Q611R

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
Pfam:Radial_spoke 209 695 2.7e-205 PFAM
low complexity region 702 716 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to be a component the radial spoke head, as determined by homology to similar proteins in the biflagellate alga Chlamydomonas reinhardtii and other ciliates. Radial spokes, which are regularly spaced along cilia, sperm, and flagella axonemes, consist of a thin 'stalk' and a bulbous 'head' that form a signal transduction scaffold between the central pair of microtubules and dynein. Mutations in this gene cause primary ciliary dyskinesia 1, a disease arising from dysmotility of motile cilia and sperm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Rsph4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Rsph4a APN 10 33914343 missense probably damaging 1.00
IGL00536:Rsph4a APN 10 33911656 splice site probably benign
IGL00702:Rsph4a APN 10 33913072 missense probably damaging 0.99
IGL02313:Rsph4a APN 10 33905525 missense possibly damaging 0.56
IGL02556:Rsph4a APN 10 33905152 utr 5 prime probably benign
PIT4519001:Rsph4a UTSW 10 33909130 missense probably benign 0.09
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0006:Rsph4a UTSW 10 33909148 missense probably damaging 1.00
R0088:Rsph4a UTSW 10 33909353 missense probably benign 0.15
R0513:Rsph4a UTSW 10 33912991 nonsense probably null
R1559:Rsph4a UTSW 10 33909731 missense probably damaging 0.99
R1589:Rsph4a UTSW 10 33905529 missense probably benign 0.01
R1783:Rsph4a UTSW 10 33911636 missense probably damaging 1.00
R1914:Rsph4a UTSW 10 33913072 missense probably damaging 0.99
R2046:Rsph4a UTSW 10 33914543 unclassified probably benign
R2280:Rsph4a UTSW 10 33911599 missense probably benign 0.00
R2496:Rsph4a UTSW 10 33908098 missense possibly damaging 0.87
R3084:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R3086:Rsph4a UTSW 10 33909202 missense probably damaging 1.00
R4519:Rsph4a UTSW 10 33911627 nonsense probably null
R4965:Rsph4a UTSW 10 33909240 missense probably damaging 1.00
R5077:Rsph4a UTSW 10 33908279 missense probably damaging 1.00
R5264:Rsph4a UTSW 10 33909383 missense probably damaging 1.00
R5359:Rsph4a UTSW 10 33908236 missense probably benign 0.08
R5464:Rsph4a UTSW 10 33909341 missense possibly damaging 0.64
R5615:Rsph4a UTSW 10 33909328 missense probably benign 0.32
R5751:Rsph4a UTSW 10 33905793 missense probably damaging 0.99
R5763:Rsph4a UTSW 10 33905688 missense probably damaging 0.98
R5832:Rsph4a UTSW 10 33909502 missense probably benign 0.01
R6243:Rsph4a UTSW 10 33909143 missense probably damaging 1.00
R6918:Rsph4a UTSW 10 33905276 missense probably benign 0.00
R7081:Rsph4a UTSW 10 33909193 missense probably damaging 0.97
R7453:Rsph4a UTSW 10 33909293 missense probably benign 0.00
R7611:Rsph4a UTSW 10 33905477 missense probably benign 0.15
R7670:Rsph4a UTSW 10 33909033 missense probably damaging 1.00
X0057:Rsph4a UTSW 10 33905727 missense possibly damaging 0.58
X0066:Rsph4a UTSW 10 33913009 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTACTACATGTGCATGCTTAAAATT -3'
(R):5'- TCTCTTCCTTAAGCTATCATGGTAA -3'

Sequencing Primer
(F):5'- TGTGCATGCTTAAAATTATATTGGTC -3'
(R):5'- CTTACCTGCTGTGGGTAAATGAACC -3'
Posted On2018-07-23