Incidental Mutation 'R6654:Krtap12-1'
ID526563
Institutional Source Beutler Lab
Gene Symbol Krtap12-1
Ensembl Gene ENSMUSG00000069583
Gene Namekeratin associated protein 12-1
SynonymsD10Jhu14e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77720599-77721254 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 77720703 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366] [ENSMUST00000092370] [ENSMUST00000179767]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000092370
AA Change: S27P
SMART Domains Protein: ENSMUSP00000090024
Gene: ENSMUSG00000069583
AA Change: S27P

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 42 3.1e-6 PFAM
Pfam:Keratin_B2_2 20 68 3.1e-10 PFAM
Pfam:Keratin_B2_2 39 84 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179767
SMART Domains Protein: ENSMUSP00000135962
Gene: ENSMUSG00000094146

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 1.7e-8 PFAM
Pfam:Keratin_B2_2 29 74 1.8e-9 PFAM
low complexity region 88 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218482
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Krtap12-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Krtap12-1 APN 10 77720980 missense possibly damaging 0.73
IGL02005:Krtap12-1 APN 10 77720989 missense probably damaging 0.98
R1739:Krtap12-1 UTSW 10 77720992 missense possibly damaging 0.79
R3767:Krtap12-1 UTSW 10 77720895 missense probably benign 0.07
R3768:Krtap12-1 UTSW 10 77720895 missense probably benign 0.07
R3770:Krtap12-1 UTSW 10 77720895 missense probably benign 0.07
R5284:Krtap12-1 UTSW 10 77720965 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGGGTAATTGGAACACTGAGCTG -3'
(R):5'- TGGCAGCATCCAGATGACTG -3'

Sequencing Primer
(F):5'- CACTGAGCTGGGTATAAAAGCC -3'
(R):5'- TCACACAGACAGGCCGG -3'
Posted On2018-07-23