Incidental Mutation 'R6654:Nubpl'
ID526567
Institutional Source Beutler Lab
Gene Symbol Nubpl
Ensembl Gene ENSMUSG00000035142
Gene Namenucleotide binding protein-like
Synonyms2410170E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location52097737-52312744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52310733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 310 (V310E)
Ref Sequence ENSEMBL: ENSMUSP00000044292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040090]
Predicted Effect probably damaging
Transcript: ENSMUST00000040090
AA Change: V310E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044292
Gene: ENSMUSG00000035142
AA Change: V310E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ParA 65 311 1.6e-101 PFAM
Pfam:AAA_31 68 131 2.6e-9 PFAM
Pfam:MipZ 68 217 2.8e-9 PFAM
Pfam:CbiA 70 241 9.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Nubpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Nubpl APN 12 52305855 missense probably damaging 0.96
IGL01415:Nubpl APN 12 52271070 missense possibly damaging 0.91
IGL02538:Nubpl APN 12 52310694 splice site probably benign
IGL02644:Nubpl APN 12 52271058 missense probably damaging 0.99
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R3851:Nubpl UTSW 12 52144027 missense probably damaging 1.00
R4939:Nubpl UTSW 12 52181095 missense probably damaging 0.98
R5553:Nubpl UTSW 12 52181299 missense possibly damaging 0.90
R5691:Nubpl UTSW 12 52105276 intron probably benign
R5886:Nubpl UTSW 12 52181309 critical splice donor site probably null
R6899:Nubpl UTSW 12 52310753 missense probably benign
R7274:Nubpl UTSW 12 52132420 intron probably benign
R7961:Nubpl UTSW 12 52181297 nonsense probably null
Z1177:Nubpl UTSW 12 52098362 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGTACCATATACACAGCCTTATGCTC -3'
(R):5'- ATCATCATAGAGCAGCCAGC -3'

Sequencing Primer
(F):5'- CACTGTTCGTCTACACCCCAG -3'
(R):5'- AGGTTGTCAAATCAAATCTGAAAATG -3'
Posted On2018-07-23