Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:Msh3'

526570

Institutional Source

Beutler Lab

Gene Symbol

Msh3

Ensembl Gene

ENSMUSG00000014850

Gene Name

mutS homolog 3

Synonyms

Rep3, Rep-3, D13Em1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.344) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92211872-92355003 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92345042 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 321 (T321A)

Ref Sequence

ENSEMBL: ENSMUSP00000022220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]

Predicted Effect

probably benign
Transcript: ENSMUST00000022220
AA Change: T321A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: T321A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185852
AA Change: T321A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: T321A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187831

Predicted Effect

probably benign
Transcript: ENSMUST00000187874

SMART Domains

Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189376

Predicted Effect

probably benign
Transcript: ENSMUST00000190393

SMART Domains

Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	241	6.4e-10	PFAM
low complexity region	261	285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191509

SMART Domains

Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Msh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Msh3	APN	13	92344964	missense	probably damaging	1.00
IGL00983:Msh3	APN	13	92300277	missense	probably damaging	1.00
IGL01490:Msh3	APN	13	92300305	missense	probably damaging	1.00
IGL02072:Msh3	APN	13	92300295	missense	probably damaging	1.00
IGL02313:Msh3	APN	13	92349312	missense	possibly damaging	0.86
IGL02711:Msh3	APN	13	92351311	missense	probably damaging	1.00
IGL03108:Msh3	APN	13	92221088	splice site	probably benign
IGL03227:Msh3	APN	13	92285960	missense	probably damaging	0.98
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0415:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
R0457:Msh3	UTSW	13	92220997	missense	probably damaging	1.00
R0659:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0661:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0686:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0688:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0707:Msh3	UTSW	13	92347340	nonsense	probably null
R1605:Msh3	UTSW	13	92300275	missense	probably null	1.00
R1622:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R1771:Msh3	UTSW	13	92212496	missense	probably benign	0.05
R1970:Msh3	UTSW	13	92249820	splice site	probably benign
R1971:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R1971:Msh3	UTSW	13	92249820	splice site	probably benign
R2894:Msh3	UTSW	13	92342360	missense	probably benign	0.16
R3837:Msh3	UTSW	13	92354858	missense	probably damaging	1.00
R4119:Msh3	UTSW	13	92354011	intron	probably benign
R4225:Msh3	UTSW	13	92285923	missense	probably benign	0.03
R4881:Msh3	UTSW	13	92266041	intron	probably benign
R5118:Msh3	UTSW	13	92309434	splice site	probably benign
R5209:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R5817:Msh3	UTSW	13	92286000	missense	possibly damaging	0.86
R5849:Msh3	UTSW	13	92249878	missense	possibly damaging	0.81
R5851:Msh3	UTSW	13	92215522	missense	probably benign	0.00
R5940:Msh3	UTSW	13	92249843	missense	probably damaging	1.00
R6004:Msh3	UTSW	13	92342414	critical splice acceptor site	probably null
R6363:Msh3	UTSW	13	92212524	missense	probably damaging	1.00
R6510:Msh3	UTSW	13	92353264	nonsense	probably null
R6853:Msh3	UTSW	13	92312572	critical splice donor site	probably null
R7022:Msh3	UTSW	13	92235588	missense	probably damaging	1.00
R7098:Msh3	UTSW	13	92274111	missense	possibly damaging	0.95
R7103:Msh3	UTSW	13	92274800	missense	probably benign
R7148:Msh3	UTSW	13	92354822	missense	probably benign	0.18
R7171:Msh3	UTSW	13	92349298	missense	probably benign	0.00
R7317:Msh3	UTSW	13	92286004	missense	probably damaging	1.00
R7369:Msh3	UTSW	13	92299262	missense	probably benign	0.15
R7586:Msh3	UTSW	13	92349332	utr 3 prime	probably benign
R7641:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R7648:Msh3	UTSW	13	92274028	missense	probably damaging	1.00
R7674:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R8125:Msh3	UTSW	13	92299182	missense	probably benign
R8252:Msh3	UTSW	13	92221061	missense	probably damaging	1.00
R8388:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R8442:Msh3	UTSW	13	92212512	missense	probably benign	0.00
S24628:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
X0027:Msh3	UTSW	13	92274070	missense	probably damaging	0.98
X0063:Msh3	UTSW	13	92274785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCCTCATGACGTACCGCTC -3'
(R):5'- CTAGCCCCTTTGGAATTGAGAAG -3'

Sequencing Primer
(F):5'- TGACGTACCGCTCACGAC -3'
(R):5'- CCTGTTATAGTTCAGCGAAGAGAC -3'

Posted On

2018-07-23