Incidental Mutation 'R6654:Mfng'
ID526572
Institutional Source Beutler Lab
Gene Symbol Mfng
Ensembl Gene ENSMUSG00000018169
Gene NameMFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsmanic fringe
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6654 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location78755882-78773475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78759339 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 223 (T223S)
Ref Sequence ENSEMBL: ENSMUSP00000018313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018313]
PDB Structure
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE [X-RAY DIFFRACTION]
STRUCTURE OF THE CATALYTIC DOMAIN OF MOUSE MANIC FRINGE IN COMPLEX WITH UDP AND MANGANESE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018313
AA Change: T223S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018313
Gene: ENSMUSG00000018169
AA Change: T223S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Fringe 49 300 6.9e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136795
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and lunatic fringe genes. They all encode evolutionarily conserved secreted proteins that act in the Notch receptor pathway to demarcate boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit normal pancreatic development, morphology and physiology. Mice homozygous for a different knock-out allele exhibit altered lymphocyte numbers, abnormal circulating factors II, VII, IX and XI, and decreased prothrombin and partial thromboplastin time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r112 G T 17: 22,603,469 S376I possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Mfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0389:Mfng UTSW 15 78764437 missense possibly damaging 0.79
R0504:Mfng UTSW 15 78757314 missense probably benign 0.00
R1905:Mfng UTSW 15 78773086 missense probably damaging 1.00
R3871:Mfng UTSW 15 78756621 missense probably damaging 1.00
R4845:Mfng UTSW 15 78764388 missense probably benign
R4872:Mfng UTSW 15 78764388 missense probably benign
R4874:Mfng UTSW 15 78764388 missense probably benign
R4925:Mfng UTSW 15 78764388 missense probably benign
R4934:Mfng UTSW 15 78764388 missense probably benign
R5006:Mfng UTSW 15 78764388 missense probably benign
R5029:Mfng UTSW 15 78764388 missense probably benign
R5048:Mfng UTSW 15 78764388 missense probably benign
R5064:Mfng UTSW 15 78764388 missense probably benign
R5067:Mfng UTSW 15 78764388 missense probably benign
R5143:Mfng UTSW 15 78764388 missense probably benign
R5145:Mfng UTSW 15 78764388 missense probably benign
R5146:Mfng UTSW 15 78764388 missense probably benign
R5266:Mfng UTSW 15 78764388 missense probably benign
R5969:Mfng UTSW 15 78764382 missense possibly damaging 0.94
R6012:Mfng UTSW 15 78756640 missense probably damaging 1.00
R7211:Mfng UTSW 15 78773068 missense probably benign 0.12
R7793:Mfng UTSW 15 78773065 missense probably damaging 1.00
R8292:Mfng UTSW 15 78773170 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTGGGAAGACGCTCTTTC -3'
(R):5'- AGAAGAAGGGCTGTCTTTTCC -3'

Sequencing Primer
(F):5'- GGAAGACGCTCTTTCCCCAC -3'
(R):5'- TATCAGCCCATTTCTCAGGAGAGG -3'
Posted On2018-07-23