Mutagenetix > Incidental Mutations

Incidental Mutation 'R6654:Vmn2r112'

526574

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r112

Ensembl Gene

ENSMUSG00000094921

Gene Name

vomeronasal 2, receptor 112

Synonyms

EG628185

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R6654 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22601148-22619133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 22603469 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 376 (S376I)

Ref Sequence

ENSEMBL: ENSMUSP00000094994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097381]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097381
AA Change: S376I

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: S376I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.8e-32	PFAM
Pfam:NCD3G	512	565	5.8e-21	PFAM
Pfam:7tm_3	598	833	6.5e-54	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Myo7b	T	C	18: 31,990,269	I672V	possibly damaging	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Vmn2r112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Vmn2r112	APN	17	22618936	missense	probably benign	0.13
IGL01021:Vmn2r112	APN	17	22618904	missense	probably damaging	1.00
IGL01122:Vmn2r112	APN	17	22603007	missense	probably benign	0.00
IGL01360:Vmn2r112	APN	17	22618622	missense	probably benign	0.03
IGL01536:Vmn2r112	APN	17	22605155	missense	probably damaging	1.00
IGL02148:Vmn2r112	APN	17	22619032	missense	probably damaging	1.00
IGL02465:Vmn2r112	APN	17	22614994	missense	probably damaging	1.00
PIT4576001:Vmn2r112	UTSW	17	22614931	missense	probably benign	0.00
R0278:Vmn2r112	UTSW	17	22603006	missense	probably benign	0.44
R0328:Vmn2r112	UTSW	17	22605270	missense	probably benign	0.01
R0583:Vmn2r112	UTSW	17	22618949	missense	probably damaging	1.00
R0831:Vmn2r112	UTSW	17	22614999	missense	probably damaging	0.99
R1080:Vmn2r112	UTSW	17	22618999	missense	probably damaging	1.00
R1245:Vmn2r112	UTSW	17	22603247	missense	probably benign	0.03
R1321:Vmn2r112	UTSW	17	22618519	nonsense	probably null
R1381:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R1514:Vmn2r112	UTSW	17	22602844	missense	probably benign	0.40
R1519:Vmn2r112	UTSW	17	22618903	missense	possibly damaging	0.83
R1572:Vmn2r112	UTSW	17	22603144	missense	possibly damaging	0.61
R1590:Vmn2r112	UTSW	17	22615008	critical splice donor site	probably null
R1640:Vmn2r112	UTSW	17	22605116	missense	probably benign	0.01
R2221:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2223:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2310:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2312:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2337:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2339:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2340:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2341:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2342:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2401:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2860:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2861:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2926:Vmn2r112	UTSW	17	22615003	missense	possibly damaging	0.90
R3236:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3237:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3977:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3979:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R4168:Vmn2r112	UTSW	17	22603088	missense	probably benign	0.01
R4256:Vmn2r112	UTSW	17	22618412	missense	probably damaging	1.00
R4386:Vmn2r112	UTSW	17	22601322	missense	probably benign	0.36
R4912:Vmn2r112	UTSW	17	22603382	missense	probably damaging	0.99
R4947:Vmn2r112	UTSW	17	22602879	missense	probably benign	0.02
R5446:Vmn2r112	UTSW	17	22618250	missense	probably damaging	1.00
R5870:Vmn2r112	UTSW	17	22619023	missense	probably benign	0.00
R6351:Vmn2r112	UTSW	17	22601278	missense	probably benign
R6384:Vmn2r112	UTSW	17	22605155	missense	probably damaging	1.00
R6390:Vmn2r112	UTSW	17	22605249	missense	probably benign	0.01
R6401:Vmn2r112	UTSW	17	22603551	nonsense	probably null
R6405:Vmn2r112	UTSW	17	22618235	missense	probably damaging	1.00
R6620:Vmn2r112	UTSW	17	22603101	missense	probably benign	0.00
R6648:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R6649:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6653:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6700:Vmn2r112	UTSW	17	22603481	missense	possibly damaging	0.53
R6993:Vmn2r112	UTSW	17	22603214	missense	probably benign	0.01
R7052:Vmn2r112	UTSW	17	22602526	missense	probably benign
R7454:Vmn2r112	UTSW	17	22603307	missense	probably benign	0.00
R7763:Vmn2r112	UTSW	17	22603118	missense	probably damaging	1.00
R8032:Vmn2r112	UTSW	17	22603394	missense	probably benign	0.21
R8177:Vmn2r112	UTSW	17	22603613	missense	possibly damaging	0.47
R8263:Vmn2r112	UTSW	17	22605159	missense	probably damaging	1.00
R8395:Vmn2r112	UTSW	17	22618606	missense	possibly damaging	0.94
Z1088:Vmn2r112	UTSW	17	22605078	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGATGTCAGTCCTAGTATGAAAGAC -3'
(R):5'- AGAAACATTACCTTCTTGCAGC -3'

Sequencing Primer
(F):5'- GTCAGTCCTAGTATGAAAGACTTTAC -3'
(R):5'- ACCTTCTTGCAGCTATAATTGTG -3'

Posted On

2018-07-23