Incidental Mutation 'R6654:Vmn2r112'
ID526574
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Namevomeronasal 2, receptor 112
SynonymsEG628185
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6654 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location22601148-22619133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22603469 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 376 (S376I)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097381
AA Change: S376I

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: S376I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T A 2: 111,171,884 M154L unknown Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Armc6 T C 8: 70,231,375 E9G probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ddc A T 11: 11,880,452 I64N probably damaging Het
Exd1 T A 2: 119,524,717 probably null Het
Gm13757 T G 2: 88,446,672 T89P possibly damaging Het
Gm15922 A T 7: 3,735,929 S560T probably benign Het
Gm4847 C A 1: 166,630,387 G466C probably damaging Het
Gm5431 T C 11: 48,894,600 D316G possibly damaging Het
Gsta4 T C 9: 78,209,099 F197L probably damaging Het
Irs2 A G 8: 11,006,486 Y649H probably damaging Het
Kif16b T C 2: 142,701,277 probably benign Het
Krtap12-1 T C 10: 77,720,703 probably benign Het
Ktn1 G A 14: 47,690,000 S537N probably damaging Het
Med12l G T 3: 59,262,292 G1626W probably damaging Het
Mfng T A 15: 78,759,339 T223S probably damaging Het
Msh3 T C 13: 92,345,042 T321A probably benign Het
Myo7b T C 18: 31,990,269 I672V possibly damaging Het
Nbas C T 12: 13,483,874 Q1837* probably null Het
Nlrc4 G A 17: 74,445,528 A620V possibly damaging Het
Nubpl T A 12: 52,310,733 V310E probably damaging Het
Olfr1109 A G 2: 87,093,050 S116P probably benign Het
P2ry12 A G 3: 59,218,020 L78P probably damaging Het
Pkd1l3 T G 8: 109,624,283 S587A probably benign Het
Prkacb A G 3: 146,750,543 V145A possibly damaging Het
Rpgrip1l T C 8: 91,220,205 E1256G probably benign Het
Rsph4a A G 10: 33,912,992 Q611R probably benign Het
Sorl1 T C 9: 41,980,645 D1903G possibly damaging Het
Tmem39b A T 4: 129,686,826 V291D probably damaging Het
Unc79 A C 12: 103,079,048 K685Q probably damaging Het
Unc79 A T 12: 103,079,049 K685I probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp850 A T 7: 27,985,215 C35* probably null Het
Zfp974 A G 7: 27,926,403 V14A probably damaging Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2340:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2342:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3237:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5446:Vmn2r112 UTSW 17 22618250 missense probably damaging 1.00
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6653:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
R8177:Vmn2r112 UTSW 17 22603613 missense possibly damaging 0.47
R8263:Vmn2r112 UTSW 17 22605159 missense probably damaging 1.00
R8395:Vmn2r112 UTSW 17 22618606 missense possibly damaging 0.94
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGATGTCAGTCCTAGTATGAAAGAC -3'
(R):5'- AGAAACATTACCTTCTTGCAGC -3'

Sequencing Primer
(F):5'- GTCAGTCCTAGTATGAAAGACTTTAC -3'
(R):5'- ACCTTCTTGCAGCTATAATTGTG -3'
Posted On2018-07-23