Mutagenetix > Incidental Mutation

Incidental Mutation 'R6654:Myo7b'

526576

Institutional Source

Beutler Lab

Gene Symbol

Myo7b

Ensembl Gene

ENSMUSG00000024388

Gene Name

myosin VIIB

Synonyms

MMRRC Submission

044775-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6654 (G1)

Quality Score

107.008

Status

Validated

Chromosome

Chromosomal Location

31959234-32036961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31990269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 672 (I672V)

Ref Sequence

ENSEMBL: ENSMUSP00000118046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000134663]

AlphaFold

Q99MZ6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134663
AA Change: I672V

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: I672V

Domain	Start	End	E-Value	Type
MYSc	59	761	N/A	SMART
IQ	762	784	1.07e-1	SMART
IQ	785	807	7.01e-6	SMART
IQ	831	853	4.93e-1	SMART
IQ	854	876	1.63e-1	SMART
MyTH4	989	1189	1.14e-71	SMART
B41	1190	1409	3.66e-16	SMART
SH3	1501	1563	3.25e-7	SMART
MyTH4	1641	1790	7.66e-55	SMART
B41	1792	2009	8.19e-28	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	T	A	2: 111,171,884	M154L	unknown	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Armc6	T	C	8: 70,231,375	E9G	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Ddc	A	T	11: 11,880,452	I64N	probably damaging	Het
Exd1	T	A	2: 119,524,717		probably null	Het
Gm13757	T	G	2: 88,446,672	T89P	possibly damaging	Het
Gm15922	A	T	7: 3,735,929	S560T	probably benign	Het
Gm4847	C	A	1: 166,630,387	G466C	probably damaging	Het
Gm5431	T	C	11: 48,894,600	D316G	possibly damaging	Het
Gsta4	T	C	9: 78,209,099	F197L	probably damaging	Het
Irs2	A	G	8: 11,006,486	Y649H	probably damaging	Het
Kif16b	T	C	2: 142,701,277		probably benign	Het
Krtap12-1	T	C	10: 77,720,703		probably benign	Het
Ktn1	G	A	14: 47,690,000	S537N	probably damaging	Het
Med12l	G	T	3: 59,262,292	G1626W	probably damaging	Het
Mfng	T	A	15: 78,759,339	T223S	probably damaging	Het
Msh3	T	C	13: 92,345,042	T321A	probably benign	Het
Nbas	C	T	12: 13,483,874	Q1837*	probably null	Het
Nlrc4	G	A	17: 74,445,528	A620V	possibly damaging	Het
Nubpl	T	A	12: 52,310,733	V310E	probably damaging	Het
Olfr1109	A	G	2: 87,093,050	S116P	probably benign	Het
P2ry12	A	G	3: 59,218,020	L78P	probably damaging	Het
Pkd1l3	T	G	8: 109,624,283	S587A	probably benign	Het
Prkacb	A	G	3: 146,750,543	V145A	possibly damaging	Het
Rpgrip1l	T	C	8: 91,220,205	E1256G	probably benign	Het
Rsph4a	A	G	10: 33,912,992	Q611R	probably benign	Het
Sorl1	T	C	9: 41,980,645	D1903G	possibly damaging	Het
Tmem39b	A	T	4: 129,686,826	V291D	probably damaging	Het
Unc79	A	C	12: 103,079,048	K685Q	probably damaging	Het
Unc79	A	T	12: 103,079,049	K685I	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r112	G	T	17: 22,603,469	S376I	possibly damaging	Het
Zfp850	A	T	7: 27,985,215	C35*	probably null	Het
Zfp974	A	G	7: 27,926,403	V14A	probably damaging	Het

Other mutations in Myo7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Myo7b	APN	18	32021556	utr 5 prime	probably benign
IGL01799:Myo7b	APN	18	31962770	missense	probably damaging	1.00
IGL01881:Myo7b	APN	18	32000267	splice site	probably benign
IGL01883:Myo7b	APN	18	31998151	missense	probably damaging	1.00
IGL01934:Myo7b	APN	18	32001341	critical splice donor site	probably null
IGL01980:Myo7b	APN	18	31961900	missense	possibly damaging	0.86
IGL02506:Myo7b	APN	18	31967154	missense	probably damaging	1.00
IGL02704:Myo7b	APN	18	31966961	missense	probably benign	0.13
IGL02929:Myo7b	APN	18	31994925	missense	probably benign	0.19
IGL03149:Myo7b	APN	18	32014302	missense	probably damaging	1.00
IGL03335:Myo7b	APN	18	31985020	missense	possibly damaging	0.81
IGL03372:Myo7b	APN	18	31998601	missense	probably damaging	1.00
IGL03385:Myo7b	APN	18	31989577	missense	probably benign	0.00
PIT4131001:Myo7b	UTSW	18	31961206	missense	probably benign	0.17
PIT4445001:Myo7b	UTSW	18	31959466	missense	possibly damaging	0.80
PIT4445001:Myo7b	UTSW	18	31962352	missense	probably damaging	0.96
R0034:Myo7b	UTSW	18	31960860	missense	probably damaging	1.00
R0138:Myo7b	UTSW	18	32010151	missense	probably damaging	1.00
R0149:Myo7b	UTSW	18	32014209	missense	probably damaging	1.00
R0226:Myo7b	UTSW	18	31972896	missense	probably benign	0.00
R0312:Myo7b	UTSW	18	32014337	missense	possibly damaging	0.68
R0361:Myo7b	UTSW	18	32014209	missense	probably damaging	1.00
R0506:Myo7b	UTSW	18	31964386	critical splice donor site	probably null
R0524:Myo7b	UTSW	18	32013424	missense	possibly damaging	0.91
R0645:Myo7b	UTSW	18	31994909	missense	probably benign	0.10
R0724:Myo7b	UTSW	18	32005549	splice site	probably benign
R0731:Myo7b	UTSW	18	31961825	splice site	probably null
R0762:Myo7b	UTSW	18	31983944	missense	probably benign	0.01
R0843:Myo7b	UTSW	18	31974084	missense	possibly damaging	0.83
R0894:Myo7b	UTSW	18	32000070	missense	probably damaging	1.00
R0966:Myo7b	UTSW	18	31998763	missense	probably damaging	1.00
R1205:Myo7b	UTSW	18	31994342	missense	probably damaging	1.00
R1387:Myo7b	UTSW	18	31983752	splice site	probably benign
R1523:Myo7b	UTSW	18	31966876	missense	probably damaging	1.00
R1544:Myo7b	UTSW	18	31994909	missense	probably benign	0.10
R1623:Myo7b	UTSW	18	32000051	missense	probably damaging	1.00
R1780:Myo7b	UTSW	18	31961185	missense	probably damaging	1.00
R1785:Myo7b	UTSW	18	31994897	missense	probably benign
R1786:Myo7b	UTSW	18	31994897	missense	probably benign
R1796:Myo7b	UTSW	18	31986675	missense	possibly damaging	0.93
R1907:Myo7b	UTSW	18	31976999	missense	possibly damaging	0.89
R2027:Myo7b	UTSW	18	31984960	missense	probably benign
R2102:Myo7b	UTSW	18	31999978	missense	probably damaging	1.00
R2174:Myo7b	UTSW	18	31983557	missense	probably damaging	1.00
R2272:Myo7b	UTSW	18	31977043	missense	probably benign	0.41
R2323:Myo7b	UTSW	18	31971345	missense	probably damaging	1.00
R2365:Myo7b	UTSW	18	32014331	missense	probably damaging	0.98
R3078:Myo7b	UTSW	18	31967184	missense	probably benign	0.04
R3522:Myo7b	UTSW	18	32010079	missense	probably damaging	1.00
R3788:Myo7b	UTSW	18	31974112	missense	possibly damaging	0.95
R3880:Myo7b	UTSW	18	31969514	missense	probably damaging	0.96
R4334:Myo7b	UTSW	18	31976987	missense	probably damaging	1.00
R4343:Myo7b	UTSW	18	31983627	missense	probably damaging	1.00
R4497:Myo7b	UTSW	18	32014229	missense	probably benign	0.06
R4498:Myo7b	UTSW	18	32014229	missense	probably benign	0.06
R4551:Myo7b	UTSW	18	31985108	missense	probably benign	0.01
R4593:Myo7b	UTSW	18	32013375	missense	possibly damaging	0.77
R4616:Myo7b	UTSW	18	32003487	splice site	probably null
R4646:Myo7b	UTSW	18	31994369	missense	probably benign	0.25
R4648:Myo7b	UTSW	18	31967125	splice site	probably null
R4737:Myo7b	UTSW	18	31998602	missense	probably damaging	1.00
R4765:Myo7b	UTSW	18	31961900	missense	probably benign	0.00
R4790:Myo7b	UTSW	18	32000105	splice site	probably null
R4909:Myo7b	UTSW	18	31964436	missense	probably benign	0.01
R5027:Myo7b	UTSW	18	31975212	missense	probably benign	0.22
R5034:Myo7b	UTSW	18	31971387	missense	probably damaging	1.00
R5112:Myo7b	UTSW	18	31983587	missense	probably damaging	1.00
R5266:Myo7b	UTSW	18	31998734	missense	probably damaging	1.00
R5267:Myo7b	UTSW	18	31998734	missense	probably damaging	1.00
R5348:Myo7b	UTSW	18	31983919	missense	probably damaging	0.96
R5457:Myo7b	UTSW	18	31971450	splice site	probably null
R5540:Myo7b	UTSW	18	32007090	missense	probably damaging	1.00
R5628:Myo7b	UTSW	18	31974187	missense	probably benign
R5815:Myo7b	UTSW	18	31966288	missense	probably damaging	1.00
R6062:Myo7b	UTSW	18	31967990	missense	possibly damaging	0.94
R6137:Myo7b	UTSW	18	31999974	missense	probably damaging	1.00
R6158:Myo7b	UTSW	18	31988549	missense	probably benign	0.00
R6218:Myo7b	UTSW	18	31959454	missense	probably benign	0.10
R6256:Myo7b	UTSW	18	31983695	missense	probably damaging	1.00
R6257:Myo7b	UTSW	18	32013415	missense	probably damaging	1.00
R6265:Myo7b	UTSW	18	31998150	missense	probably damaging	1.00
R6302:Myo7b	UTSW	18	31994386	missense	probably damaging	0.98
R6438:Myo7b	UTSW	18	31966329	missense	probably damaging	1.00
R7030:Myo7b	UTSW	18	31971573	missense	probably damaging	1.00
R7090:Myo7b	UTSW	18	31998712	missense	probably damaging	1.00
R7210:Myo7b	UTSW	18	32007102	missense	probably damaging	1.00
R7218:Myo7b	UTSW	18	31981001	missense	probably benign	0.05
R7378:Myo7b	UTSW	18	31966239	missense	probably damaging	1.00
R7458:Myo7b	UTSW	18	31988551	missense	possibly damaging	0.89
R7517:Myo7b	UTSW	18	32013267	missense	probably damaging	0.99
R7559:Myo7b	UTSW	18	31983360	missense	probably benign	0.01
R7667:Myo7b	UTSW	18	31961905	missense	probably benign
R7737:Myo7b	UTSW	18	32014204	nonsense	probably null
R7942:Myo7b	UTSW	18	32013369	missense	probably damaging	0.98
R8030:Myo7b	UTSW	18	31998082	missense	probably damaging	0.96
R8114:Myo7b	UTSW	18	31965624	missense	probably damaging	1.00
R8338:Myo7b	UTSW	18	31971355	missense	probably damaging	0.96
R8341:Myo7b	UTSW	18	31983926	missense	probably benign	0.39
R8406:Myo7b	UTSW	18	31959813	missense	probably damaging	1.00
R8464:Myo7b	UTSW	18	31962704	missense	probably benign	0.00
R8517:Myo7b	UTSW	18	31967191	missense	possibly damaging	0.87
R8537:Myo7b	UTSW	18	31977089	missense	probably benign	0.08
R8546:Myo7b	UTSW	18	31990148	missense	probably benign	0.19
R8721:Myo7b	UTSW	18	32007011	missense	probably damaging	1.00
R8770:Myo7b	UTSW	18	31981071	missense	probably benign	0.03
R8841:Myo7b	UTSW	18	31964437	missense	probably benign	0.06
R8853:Myo7b	UTSW	18	31986691	missense	possibly damaging	0.67
R8960:Myo7b	UTSW	18	31994246	splice site	probably benign
R8984:Myo7b	UTSW	18	31966349	missense	probably null	0.68
R9356:Myo7b	UTSW	18	31977043	missense	probably damaging	1.00
R9357:Myo7b	UTSW	18	31960076	missense	probably damaging	1.00
R9364:Myo7b	UTSW	18	32000360	missense	probably benign	0.12
R9405:Myo7b	UTSW	18	31976303	missense	probably benign	0.00
R9533:Myo7b	UTSW	18	31975244	missense	probably benign	0.27
R9776:Myo7b	UTSW	18	32000015	missense	probably benign	0.45
X0027:Myo7b	UTSW	18	31965636	missense	probably damaging	1.00
Z1176:Myo7b	UTSW	18	31980998	missense	possibly damaging	0.82
Z1177:Myo7b	UTSW	18	31985056	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACGGAAGGCACAAGATTC -3'
(R):5'- AGGCAGAATGGCATGCTCAG -3'

Sequencing Primer
(F):5'- GCACAAGATTCAATGGCCTCTTAGG -3'
(R):5'- GCTCAGCTATATATCAAATTCTGGGC -3'

Posted On

2018-07-23