Incidental Mutation 'R6655:Ttll9'
ID 526580
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Name tubulin tyrosine ligase-like family, member 9
Synonyms 4930509O20Rik, 1700016F23Rik
MMRRC Submission 044776-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6655 (G1)
Quality Score 138.008
Status Not validated
Chromosome 2
Chromosomal Location 152804405-152850402 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 152842223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
AlphaFold A2APC3
Predicted Effect probably null
Transcript: ENSMUST00000099197
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103155
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109801
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect probably benign
Transcript: ENSMUST00000165343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,431,815 (GRCm39) D130V probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Alg3 T A 16: 20,427,776 (GRCm39) Y12F probably benign Het
Arhgef28 A G 13: 98,036,163 (GRCm39) Y1699H probably damaging Het
Cd109 A G 9: 78,592,220 (GRCm39) D778G probably benign Het
Dlc1 A G 8: 37,039,870 (GRCm39) V1430A probably damaging Het
Dscaml1 G A 9: 45,658,235 (GRCm39) V1669I probably benign Het
Fkbp8 A G 8: 70,985,320 (GRCm39) Y278C probably damaging Het
Gm5160 T C 18: 14,558,187 (GRCm39) F88S possibly damaging Het
Kcnh1 A G 1: 192,095,391 (GRCm39) N483S possibly damaging Het
Lrp2 A G 2: 69,284,202 (GRCm39) S3859P probably benign Het
Myof T C 19: 37,923,239 (GRCm39) N1351S probably damaging Het
Nbn A G 4: 15,981,696 (GRCm39) E596G probably damaging Het
Neurl4 T C 11: 69,801,742 (GRCm39) probably null Het
Nol8 T C 13: 49,807,868 (GRCm39) L10P probably damaging Het
Or2t46 T A 11: 58,472,036 (GRCm39) M122K probably damaging Het
Or6c213 T C 10: 129,573,956 (GRCm39) T277A possibly damaging Het
Pex26 T C 6: 121,167,170 (GRCm39) probably benign Het
Rab3gap2 T C 1: 184,982,208 (GRCm39) M420T probably damaging Het
Samd9l C A 6: 3,377,247 (GRCm39) V5L probably benign Het
Sec22b T A 3: 97,821,964 (GRCm39) probably null Het
Shank1 A G 7: 43,976,644 (GRCm39) I581V unknown Het
Ssbp2 C T 13: 91,812,268 (GRCm39) P105L probably damaging Het
Veph1 T A 3: 66,113,034 (GRCm39) I257F possibly damaging Het
Vmn1r222 A C 13: 23,416,886 (GRCm39) I109S probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wnt16 T C 6: 22,290,965 (GRCm39) V131A probably damaging Het
Zfp747l1 A G 7: 126,983,512 (GRCm39) L530P possibly damaging Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152,826,180 (GRCm39) missense probably damaging 0.99
IGL01107:Ttll9 APN 2 152,844,809 (GRCm39) splice site probably benign
IGL01365:Ttll9 APN 2 152,842,054 (GRCm39) missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152,825,025 (GRCm39) missense probably damaging 0.99
IGL02264:Ttll9 APN 2 152,842,055 (GRCm39) missense probably damaging 1.00
IGL02477:Ttll9 APN 2 152,842,117 (GRCm39) missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 152,844,871 (GRCm39) missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
BB011:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
I2288:Ttll9 UTSW 2 152,814,259 (GRCm39) splice site probably benign
R0053:Ttll9 UTSW 2 152,804,426 (GRCm39) utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152,825,054 (GRCm39) missense probably damaging 0.99
R0319:Ttll9 UTSW 2 152,842,018 (GRCm39) splice site probably null
R0388:Ttll9 UTSW 2 152,842,099 (GRCm39) missense probably benign
R0556:Ttll9 UTSW 2 152,815,526 (GRCm39) critical splice donor site probably null
R0689:Ttll9 UTSW 2 152,825,047 (GRCm39) missense probably benign 0.05
R1829:Ttll9 UTSW 2 152,842,156 (GRCm39) missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 152,844,214 (GRCm39) missense probably damaging 1.00
R2144:Ttll9 UTSW 2 152,844,927 (GRCm39) missense probably benign
R2229:Ttll9 UTSW 2 152,824,983 (GRCm39) missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152,826,065 (GRCm39) missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152,825,047 (GRCm39) missense probably benign 0.05
R4191:Ttll9 UTSW 2 152,844,927 (GRCm39) missense probably benign
R4539:Ttll9 UTSW 2 152,836,011 (GRCm39) missense probably damaging 1.00
R4866:Ttll9 UTSW 2 152,844,920 (GRCm39) missense probably benign 0.02
R5115:Ttll9 UTSW 2 152,831,510 (GRCm39) intron probably benign
R5279:Ttll9 UTSW 2 152,804,464 (GRCm39) missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152,833,572 (GRCm39) missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152,826,144 (GRCm39) missense probably benign 0.13
R5417:Ttll9 UTSW 2 152,844,912 (GRCm39) missense probably benign
R5555:Ttll9 UTSW 2 152,832,020 (GRCm39) critical splice donor site probably null
R5574:Ttll9 UTSW 2 152,826,168 (GRCm39) missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152,826,234 (GRCm39) missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152,815,521 (GRCm39) frame shift probably null
R6366:Ttll9 UTSW 2 152,833,525 (GRCm39) missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152,841,261 (GRCm39) missense probably damaging 1.00
R6657:Ttll9 UTSW 2 152,826,182 (GRCm39) missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152,841,220 (GRCm39) nonsense probably null
R7012:Ttll9 UTSW 2 152,844,982 (GRCm39) missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152,831,523 (GRCm39) missense probably damaging 0.99
R7804:Ttll9 UTSW 2 152,844,278 (GRCm39) critical splice donor site probably null
R7862:Ttll9 UTSW 2 152,848,895 (GRCm39) missense probably benign 0.00
R7924:Ttll9 UTSW 2 152,804,407 (GRCm39) unclassified probably benign
R7998:Ttll9 UTSW 2 152,833,546 (GRCm39) missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 152,844,956 (GRCm39) missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152,836,068 (GRCm39) missense probably benign
R8897:Ttll9 UTSW 2 152,844,841 (GRCm39) missense probably damaging 0.99
R9061:Ttll9 UTSW 2 152,818,113 (GRCm39) missense possibly damaging 0.46
R9667:Ttll9 UTSW 2 152,831,989 (GRCm39) nonsense probably null
R9716:Ttll9 UTSW 2 152,818,136 (GRCm39) missense probably benign 0.00
R9780:Ttll9 UTSW 2 152,836,023 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCAGCGCTTCAGGCAGTAC -3'
(R):5'- GATCCCTTTAGAAGAGGCCTGC -3'

Sequencing Primer
(F):5'- GCAGTACCTGGCTTCCAAG -3'
(R):5'- AGAGGCCTGCACCGATTAGATC -3'
Posted On 2018-07-23