Incidental Mutation 'R6655:Samd9l'
ID526585
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6655 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3377247 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 5 (V5L)
Ref Sequence ENSEMBL: ENSMUSP00000144632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably benign
Transcript: ENSMUST00000120087
AA Change: V5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: V5L

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
AA Change: V5L

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735
AA Change: V5L

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm13178 T A 4: 144,705,245 D130V probably damaging Het
Gm5160 T C 18: 14,425,130 F88S possibly damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Nbn A G 4: 15,981,696 E596G probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4602:Samd9l UTSW 6 3373937 frame shift probably null
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
R7610:Samd9l UTSW 6 3376754 missense probably benign
R7667:Samd9l UTSW 6 3375975 missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3373646 missense probably benign 0.16
R7680:Samd9l UTSW 6 3372569 missense probably damaging 1.00
R7680:Samd9l UTSW 6 3376469 missense probably damaging 1.00
R7814:Samd9l UTSW 6 3374793 missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3374749 missense probably benign 0.00
R8000:Samd9l UTSW 6 3373034 missense probably damaging 1.00
R8098:Samd9l UTSW 6 3375549 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3376770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCAGAAGTGCTGGACCCC -3'
(R):5'- CTGTGAAATGAGCAATACTTAGGGC -3'

Sequencing Primer
(F):5'- CTGGACCCCGTGGCAAG -3'
(R):5'- TAGGGCAATGTATAGAATGAATCCC -3'
Posted On2018-07-23