Incidental Mutation 'R6655:Akr1b3'
ID526587
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6655 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34310004 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 206 (V206M)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102980
AA Change: V206M

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V206M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm13178 T A 4: 144,705,245 D130V probably damaging Het
Gm5160 T C 18: 14,425,130 F88S possibly damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Nbn A G 4: 15,981,696 E596G probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Samd9l C A 6: 3,377,247 V5L probably benign Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGAAGAATATCCATCTTGTTCC -3'
(R):5'- GCCATCAACTGGGAAATGTGG -3'

Sequencing Primer
(F):5'- TTCCTAGGAACATCAACCTCCCAG -3'
(R):5'- GGGGGAGTTGTTACAGCTTATC -3'
Posted On2018-07-23