Mutagenetix > Incidental Mutation

Incidental Mutation 'R6655:Nol8'

526599

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49654392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 10 (L10P)

Ref Sequence

ENSEMBL: ENSMUSP00000152878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]

AlphaFold

Q3UHX0

Predicted Effect

probably benign
Transcript: ENSMUST00000021818

SMART Domains

Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

Domain	Start	End	E-Value	Type
coiled coil region	1	34	N/A	INTRINSIC
Pfam:CENP-P	102	278	3.9e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000021824
AA Change: L28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: L28P

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000221083
AA Change: L10P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221142
AA Change: L10P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221751

Predicted Effect

probably damaging
Transcript: ENSMUST00000222197
AA Change: L28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222333
AA Change: L28P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223264
AA Change: L10P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223467
AA Change: L10P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	A	G	7: 127,384,340	L530P	possibly damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Alg3	T	A	16: 20,609,026	Y12F	probably benign	Het
Arhgef28	A	G	13: 97,899,655	Y1699H	probably damaging	Het
Cd109	A	G	9: 78,684,938	D778G	probably benign	Het
Dlc1	A	G	8: 36,572,716	V1430A	probably damaging	Het
Dscaml1	G	A	9: 45,746,937	V1669I	probably benign	Het
Fkbp8	A	G	8: 70,532,670	Y278C	probably damaging	Het
Gm13178	T	A	4: 144,705,245	D130V	probably damaging	Het
Gm5160	T	C	18: 14,425,130	F88S	possibly damaging	Het
Kcnh1	A	G	1: 192,413,083	N483S	possibly damaging	Het
Lrp2	A	G	2: 69,453,858	S3859P	probably benign	Het
Myof	T	C	19: 37,934,791	N1351S	probably damaging	Het
Nbn	A	G	4: 15,981,696	E596G	probably damaging	Het
Neurl4	T	C	11: 69,910,916		probably null	Het
Olfr325	T	A	11: 58,581,210	M122K	probably damaging	Het
Olfr806	T	C	10: 129,738,087	T277A	possibly damaging	Het
Pex26	T	C	6: 121,190,211		probably benign	Het
Rab3gap2	T	C	1: 185,250,011	M420T	probably damaging	Het
Samd9l	C	A	6: 3,377,247	V5L	probably benign	Het
Sec22b	T	A	3: 97,914,648		probably null	Het
Shank1	A	G	7: 44,327,220	I581V	unknown	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Ttll9	T	C	2: 153,000,303		probably null	Het
Veph1	T	A	3: 66,205,613	I257F	possibly damaging	Het
Vmn1r222	A	C	13: 23,232,716	I109S	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wnt16	T	C	6: 22,290,966	V131A	probably damaging	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2187:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4199:Nol8	UTSW	13	49661748	missense	possibly damaging	0.65
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6359:Nol8	UTSW	13	49664070	missense	probably benign	0.16
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R8246:Nol8	UTSW	13	49655248	splice site	probably benign
R9081:Nol8	UTSW	13	49661405	missense	probably benign	0.00
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGAGGGCCTTTGTAAAATCTCC -3'
(R):5'- TAACATTCAGCTCTGGGGTTG -3'

Sequencing Primer
(F):5'- TCTCCACTGATAAAATCTGAAAGC -3'
(R):5'- CTGGGGTTGCTTCTCCTGTAATATC -3'

Posted On

2018-07-23