Incidental Mutation 'R6655:Ssbp2'
ID 526600
Institutional Source Beutler Lab
Gene Symbol Ssbp2
Ensembl Gene ENSMUSG00000003992
Gene Name single-stranded DNA binding protein 2
Synonyms 9330163K02Rik, A830008M03Rik, Hspc116, Ssdp2, 2310079I02Rik, 1500004K09Rik
MMRRC Submission 044776-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6655 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 91608402-91851548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 91812268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 105 (P105L)
Ref Sequence ENSEMBL: ENSMUSP00000037115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004094] [ENSMUST00000042122] [ENSMUST00000231481]
AlphaFold Q9CYZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000004094
AA Change: P135L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004094
Gene: ENSMUSG00000003992
AA Change: P135L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 83 125 5.9e-19 PFAM
Pfam:SSDP 123 338 5.3e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042122
AA Change: P105L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037115
Gene: ENSMUSG00000003992
AA Change: P105L

DomainStartEndE-ValueType
LisH 18 50 2.18e-3 SMART
Pfam:SSDP 94 313 2.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156547
Predicted Effect probably damaging
Transcript: ENSMUST00000231481
AA Change: P135L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3679 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a protein complex that interacts with single-stranded DNA and is involved in the DNA damage response and maintenance of genome stability. The encoded protein may also play a role in telomere repair. A variant of this gene may be associated with survival in human glioblastoma patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice exhibit some perinatal lethality and premature death associated with increased incidence of lymphoma and carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AAdacl4fm3 T A 4: 144,431,815 (GRCm39) D130V probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Alg3 T A 16: 20,427,776 (GRCm39) Y12F probably benign Het
Arhgef28 A G 13: 98,036,163 (GRCm39) Y1699H probably damaging Het
Cd109 A G 9: 78,592,220 (GRCm39) D778G probably benign Het
Dlc1 A G 8: 37,039,870 (GRCm39) V1430A probably damaging Het
Dscaml1 G A 9: 45,658,235 (GRCm39) V1669I probably benign Het
Fkbp8 A G 8: 70,985,320 (GRCm39) Y278C probably damaging Het
Gm5160 T C 18: 14,558,187 (GRCm39) F88S possibly damaging Het
Kcnh1 A G 1: 192,095,391 (GRCm39) N483S possibly damaging Het
Lrp2 A G 2: 69,284,202 (GRCm39) S3859P probably benign Het
Myof T C 19: 37,923,239 (GRCm39) N1351S probably damaging Het
Nbn A G 4: 15,981,696 (GRCm39) E596G probably damaging Het
Neurl4 T C 11: 69,801,742 (GRCm39) probably null Het
Nol8 T C 13: 49,807,868 (GRCm39) L10P probably damaging Het
Or2t46 T A 11: 58,472,036 (GRCm39) M122K probably damaging Het
Or6c213 T C 10: 129,573,956 (GRCm39) T277A possibly damaging Het
Pex26 T C 6: 121,167,170 (GRCm39) probably benign Het
Rab3gap2 T C 1: 184,982,208 (GRCm39) M420T probably damaging Het
Samd9l C A 6: 3,377,247 (GRCm39) V5L probably benign Het
Sec22b T A 3: 97,821,964 (GRCm39) probably null Het
Shank1 A G 7: 43,976,644 (GRCm39) I581V unknown Het
Ttll9 T C 2: 152,842,223 (GRCm39) probably null Het
Veph1 T A 3: 66,113,034 (GRCm39) I257F possibly damaging Het
Vmn1r222 A C 13: 23,416,886 (GRCm39) I109S probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wnt16 T C 6: 22,290,965 (GRCm39) V131A probably damaging Het
Zfp747l1 A G 7: 126,983,512 (GRCm39) L530P possibly damaging Het
Other mutations in Ssbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Ssbp2 APN 13 91,817,871 (GRCm39) splice site probably benign
IGL02962:Ssbp2 APN 13 91,790,490 (GRCm39) missense possibly damaging 0.84
IGL03201:Ssbp2 APN 13 91,672,720 (GRCm39) missense probably damaging 1.00
R0190:Ssbp2 UTSW 13 91,817,829 (GRCm39) missense probably damaging 1.00
R0277:Ssbp2 UTSW 13 91,712,715 (GRCm39) splice site probably benign
R0329:Ssbp2 UTSW 13 91,828,698 (GRCm39) splice site probably null
R0330:Ssbp2 UTSW 13 91,828,698 (GRCm39) splice site probably null
R1551:Ssbp2 UTSW 13 91,790,511 (GRCm39) critical splice donor site probably null
R1846:Ssbp2 UTSW 13 91,812,268 (GRCm39) missense probably damaging 1.00
R1957:Ssbp2 UTSW 13 91,812,303 (GRCm39) splice site probably benign
R3732:Ssbp2 UTSW 13 91,672,726 (GRCm39) missense probably damaging 1.00
R3744:Ssbp2 UTSW 13 91,828,765 (GRCm39) splice site probably benign
R4469:Ssbp2 UTSW 13 91,842,175 (GRCm39) missense probably damaging 1.00
R4665:Ssbp2 UTSW 13 91,687,454 (GRCm39) missense possibly damaging 0.48
R4724:Ssbp2 UTSW 13 91,836,933 (GRCm39) missense possibly damaging 0.70
R5477:Ssbp2 UTSW 13 91,812,244 (GRCm39) missense probably damaging 0.98
R6015:Ssbp2 UTSW 13 91,817,862 (GRCm39) critical splice donor site probably null
R6332:Ssbp2 UTSW 13 91,839,027 (GRCm39) missense probably benign 0.01
R6523:Ssbp2 UTSW 13 91,841,170 (GRCm39) missense probably benign 0.09
R6548:Ssbp2 UTSW 13 91,687,470 (GRCm39) missense possibly damaging 0.91
R7227:Ssbp2 UTSW 13 91,823,244 (GRCm39) missense probably benign 0.00
R7295:Ssbp2 UTSW 13 91,842,122 (GRCm39) splice site probably null
R7401:Ssbp2 UTSW 13 91,839,002 (GRCm39) missense probably benign 0.43
R7488:Ssbp2 UTSW 13 91,823,209 (GRCm39) missense probably damaging 0.99
R7823:Ssbp2 UTSW 13 91,790,448 (GRCm39) missense possibly damaging 0.95
R8884:Ssbp2 UTSW 13 91,836,989 (GRCm39) splice site probably benign
R9147:Ssbp2 UTSW 13 91,842,141 (GRCm39) missense probably damaging 1.00
R9148:Ssbp2 UTSW 13 91,842,141 (GRCm39) missense probably damaging 1.00
R9182:Ssbp2 UTSW 13 91,848,800 (GRCm39) missense probably damaging 0.97
R9255:Ssbp2 UTSW 13 91,818,525 (GRCm39) missense possibly damaging 0.93
R9449:Ssbp2 UTSW 13 91,823,157 (GRCm39) missense probably benign 0.02
X0026:Ssbp2 UTSW 13 91,817,807 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAGGATGACAATTTTCTTGGAAGC -3'
(R):5'- TTTCCCTGTTCCAACAAAACTTAGC -3'

Sequencing Primer
(F):5'- AAGCTTTTGTTCTGCTGGAAAC -3'
(R):5'- AGTCAGTCAGCACACAGTCTGG -3'
Posted On 2018-07-23