Incidental Mutation 'R6656:Npas2'
ID526606
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6656 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39361948 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 798 (S798A)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect unknown
Transcript: ENSMUST00000056815
AA Change: S798A
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: S798A

DomainStartEndE-ValueType
HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3157:Npas2 UTSW 1 39347609 missense possibly damaging 0.92
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
R7833:Npas2 UTSW 1 39326147 missense probably damaging 1.00
R7994:Npas2 UTSW 1 39328337 missense possibly damaging 0.86
R8013:Npas2 UTSW 1 39338065 missense probably benign
R8054:Npas2 UTSW 1 39287571 missense possibly damaging 0.69
R8510:Npas2 UTSW 1 39287472 missense probably damaging 1.00
Z1176:Npas2 UTSW 1 39336010 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAGAATCTGGCAGCATCTG -3'
(R):5'- TCTGAAATGTATACAGGGTGCG -3'

Sequencing Primer
(F):5'- TCTGCTGCAAACCCCAAAGG -3'
(R):5'- TGTATACAGGGTGCGCCAAAATC -3'
Posted On2018-07-23