Incidental Mutation 'R6656:Gngt1'
ID526617
Institutional Source Beutler Lab
Gene Symbol Gngt1
Ensembl Gene ENSMUSG00000029663
Gene Nameguanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1
SynonymsG(y)1, Gng1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6656 (G1)
Quality Score219.009
Status Validated
Chromosome6
Chromosomal Location3993792-3997436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3994246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 8 (D8G)
Ref Sequence ENSEMBL: ENSMUSP00000031673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031673]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031673
AA Change: D8G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031673
Gene: ENSMUSG00000029663
AA Change: D8G

DomainStartEndE-ValueType
G_gamma 9 74 6.3e-23 SMART
GGL 12 74 3.34e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159369
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the gamma subunit of transducin, a guanine nucleotide-binding protein (G protein) that is found in rod outer segments. Transducin, also known as GMPase, mediates the activation of a cyclic GTP-specific (guanosine monophosphate) phosphodiesterase by rhodopsin. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display markedly reduced flash sensitivity of individual retinal rods and gradual retinal photoreceptor degeneration with loss of most rods by 6 months of age. Homozygous knock-in mice expressing geranylgeranylated rod transducin exhibit impaired properties in light adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Gngt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1898:Gngt1 UTSW 6 3996724 missense possibly damaging 0.96
R4434:Gngt1 UTSW 6 3994282 missense probably benign 0.01
R6158:Gngt1 UTSW 6 3994311 nonsense probably null
R6917:Gngt1 UTSW 6 3996680 missense probably benign 0.25
R7019:Gngt1 UTSW 6 3994088 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGGTAAGTGCAAAGC -3'
(R):5'- CCAAAATGTCTCCATGCCTTG -3'

Sequencing Primer
(F):5'- CCTGGTAAGTGCAAAGCAGAGG -3'
(R):5'- CACTTGGATCGGGAAAACTAGCTTTC -3'
Posted On2018-07-23