Incidental Mutation 'R6656:Cyp2b19'
ID526620
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6656 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26757142-26772630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26766855 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 361 (T361I)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
Predicted Effect probably benign
Transcript: ENSMUST00000077855
AA Change: T361I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: T361I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26759417 missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26759079 missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26759064 missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26762378 missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26762384 missense probably benign
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26766762 missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26762229 splice site probably benign
R1514:Cyp2b19 UTSW 7 26767160 missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26763340 splice site probably null
R2362:Cyp2b19 UTSW 7 26764377 missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26763382 missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26771394 missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26757292 missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26764376 missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26766821 missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26763419 missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26759427 missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26759094 missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26771392 missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26763358 missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26759111 missense probably benign
R7283:Cyp2b19 UTSW 7 26766914 missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26759064 missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26771344 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AACTGGGTCACTGTGCATCAC -3'
(R):5'- AGATGTTAACATACCCCGACTC -3'

Sequencing Primer
(F):5'- TGTGCATCACCTCCAAGAAGGG -3'
(R):5'- TTCCTAAGAAACACAGAATGCTGG -3'
Posted On2018-07-23