Incidental Mutation 'R6656:B3galnt2'
ID526635
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6656 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13975576 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 168 (A168V)
Ref Sequence ENSEMBL: ENSMUSP00000152397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099747] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000222110] [ENSMUST00000223483]
Predicted Effect probably benign
Transcript: ENSMUST00000099747
AA Change: A168V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242
AA Change: A168V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221021
Predicted Effect probably benign
Transcript: ENSMUST00000221300
AA Change: A168V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect unknown
Transcript: ENSMUST00000221333
AA Change: A118V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221764
Predicted Effect probably benign
Transcript: ENSMUST00000221974
AA Change: A168V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222015
Predicted Effect probably benign
Transcript: ENSMUST00000222110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223389
Predicted Effect probably benign
Transcript: ENSMUST00000223483
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Keg1 C T 19: 12,709,630 Q8* probably null Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3686:B3galnt2 UTSW 13 13975635 critical splice donor site probably null
R3954:B3galnt2 UTSW 13 13966454 missense probably benign 0.04
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5564:B3galnt2 UTSW 13 13995229 missense probably damaging 1.00
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7582:B3galnt2 UTSW 13 13991401 missense probably damaging 1.00
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
R8135:B3galnt2 UTSW 13 13970869 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTCCCATGTAGATAGATGCC -3'
(R):5'- GCATTGCAATACAACATACTGTCAG -3'

Sequencing Primer
(F):5'- CTCCCATGTAGATAGATGCCTTGGAG -3'
(R):5'- CTGTCAGTTCAACCAATATAGGAAG -3'
Posted On2018-07-23