Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Sec16a'

526643

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 26425864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 262 (W262*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably null
Transcript: ENSMUST00000091252
AA Change: W1713*

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: W1713*

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114082
AA Change: W1713*

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: W1713*

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000156442
AA Change: W262*

SMART Domains

Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: W262*

Domain	Start	End	E-Value	Type
Pfam:Sec16	14	114	7.7e-11	PFAM
low complexity region	150	164	N/A	INTRINSIC
Pfam:Sec16_C	186	438	1.6e-45	PFAM
low complexity region	659	674	N/A	INTRINSIC
low complexity region	715	727	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	777	792	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAACTCTTCAGGCAAGGTGC -3'
(R):5'- AGTCCAGTGTGATTTGTGCATAC -3'

Sequencing Primer
(F):5'- GAAAGCCACATCTCTTATGGTTCTGG -3'
(R):5'- GTGCATACTGAAGACTTTGACTATGG -3'

Posted On

2018-07-23