Incidental Mutation 'R6657:Sec16a'
ID 526643
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene Name SEC16 homolog A, endoplasmic reticulum export factor
Synonyms C230052J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 26409431-26445216 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 26425864 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 262 (W262*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
AlphaFold E9QAT4
Predicted Effect probably null
Transcript: ENSMUST00000091252
AA Change: W1713*
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: W1713*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114082
AA Change: W1713*
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: W1713*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156442
AA Change: W262*
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924
AA Change: W262*

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 splice site probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
R7981:Sec16a UTSW 2 26421372 critical splice donor site probably null
R8117:Sec16a UTSW 2 26441429 missense probably benign 0.00
R8131:Sec16a UTSW 2 26410946 missense
R8163:Sec16a UTSW 2 26416421 missense
R8825:Sec16a UTSW 2 26423574 missense
R8855:Sec16a UTSW 2 26439840 missense probably benign 0.16
R9165:Sec16a UTSW 2 26423633 missense
R9216:Sec16a UTSW 2 26414389 missense
R9283:Sec16a UTSW 2 26423892 missense
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAACTCTTCAGGCAAGGTGC -3'
(R):5'- AGTCCAGTGTGATTTGTGCATAC -3'

Sequencing Primer
(F):5'- GAAAGCCACATCTCTTATGGTTCTGG -3'
(R):5'- GTGCATACTGAAGACTTTGACTATGG -3'
Posted On 2018-07-23