Incidental Mutation 'R6657:Tnfaip6'
ID 526644
Institutional Source Beutler Lab
Gene Symbol Tnfaip6
Ensembl Gene ENSMUSG00000053475
Gene Name tumor necrosis factor alpha induced protein 6
Synonyms Tnfip6, TSG-6, Tsg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 52038009-52056686 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 52043783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 50 (T50N)
Ref Sequence ENSEMBL: ENSMUSP00000069231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065927]
AlphaFold O08859
Predicted Effect probably damaging
Transcript: ENSMUST00000065927
AA Change: T50N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069231
Gene: ENSMUSG00000053475
AA Change: T50N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LINK 34 129 1.06e-53 SMART
CUB 135 247 2.66e-47 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
PHENOTYPE: Females lacking functional copies of this gene are infertile due to failed cumulus-oocyte complex expansion. Mice show attenuated acute allergic pulmonary inflammation and are resistant to induction of airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Tnfaip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tnfaip6 APN 2 52055847 missense probably damaging 1.00
IGL01565:Tnfaip6 APN 2 52055834 missense probably damaging 1.00
R0118:Tnfaip6 UTSW 2 52043815 nonsense probably null
R0279:Tnfaip6 UTSW 2 52055916 missense possibly damaging 0.95
R2138:Tnfaip6 UTSW 2 52052332 missense possibly damaging 0.51
R2152:Tnfaip6 UTSW 2 52043730 missense probably damaging 1.00
R2240:Tnfaip6 UTSW 2 52050914 missense probably benign 0.16
R3877:Tnfaip6 UTSW 2 52052327 missense probably benign 0.27
R4235:Tnfaip6 UTSW 2 52050864 missense probably damaging 0.99
R4857:Tnfaip6 UTSW 2 52051074 splice site probably null
R5658:Tnfaip6 UTSW 2 52051035 missense possibly damaging 0.66
R6476:Tnfaip6 UTSW 2 52052316 missense probably benign
R7424:Tnfaip6 UTSW 2 52038216 missense probably benign 0.00
R7980:Tnfaip6 UTSW 2 52051058 missense probably damaging 1.00
R8353:Tnfaip6 UTSW 2 52055867 missense probably benign 0.00
R8453:Tnfaip6 UTSW 2 52055867 missense probably benign 0.00
R8772:Tnfaip6 UTSW 2 52051065 missense possibly damaging 0.95
R8798:Tnfaip6 UTSW 2 52043812 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TAACTACCGTGGCAGCTGAC -3'
(R):5'- ATCACATAGAGAATGGTCCCAAAG -3'

Sequencing Primer
(F):5'- CGTGGCAGCTGACCTAGAAATTTC -3'
(R):5'- ATGGTCCCAAAGGGCTTG -3'
Posted On 2018-07-23