Incidental Mutation 'R6657:Olfr1109'
ID526645
Institutional Source Beutler Lab
Gene Symbol Olfr1109
Ensembl Gene ENSMUSG00000075161
Gene Nameolfactory receptor 1109
SynonymsMOR172-5, GA_x6K02T2Q125-48586461-48585523
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6657 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87091195-87096008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87093059 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 113 (I113F)
Ref Sequence ENSEMBL: ENSMUSP00000149282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099863] [ENSMUST00000214636] [ENSMUST00000217066]
Predicted Effect probably benign
Transcript: ENSMUST00000099863
AA Change: I113F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097449
Gene: ENSMUSG00000075161
AA Change: I113F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.3e-52 PFAM
Pfam:7tm_1 41 290 6.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214636
AA Change: I113F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217066
AA Change: I113F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Olfr1109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Olfr1109 APN 2 87093299 missense probably benign
IGL01926:Olfr1109 APN 2 87092974 missense probably damaging 1.00
IGL03195:Olfr1109 APN 2 87092569 missense probably damaging 1.00
R0550:Olfr1109 UTSW 2 87093129 missense probably benign 0.00
R1334:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R1677:Olfr1109 UTSW 2 87092737 missense probably benign
R1753:Olfr1109 UTSW 2 87093227 missense probably damaging 0.98
R3933:Olfr1109 UTSW 2 87092762 missense probably benign 0.01
R4151:Olfr1109 UTSW 2 87093170 missense probably benign 0.07
R4296:Olfr1109 UTSW 2 87092630 missense probably benign 0.00
R6654:Olfr1109 UTSW 2 87093050 missense probably benign 0.23
R7697:Olfr1109 UTSW 2 87092818 missense probably benign 0.30
R8178:Olfr1109 UTSW 2 87092876 missense possibly damaging 0.94
R8413:Olfr1109 UTSW 2 87093158 missense probably benign 0.25
Z1176:Olfr1109 UTSW 2 87093224 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTCACAACGTTGGGACCACAG -3'
(R):5'- GGGTAACTGGGGAATGATCTTC -3'

Sequencing Primer
(F):5'- CGTTGGGACCACAGAAGTC -3'
(R):5'- GATCTGGTTGAATGCCCACC -3'
Posted On2018-07-23