Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Sqor'

526648

Institutional Source

Beutler Lab

Gene Symbol

Sqor

Ensembl Gene

ENSMUSG00000005803

Gene Name

sulfide quinone oxidoreductase

Synonyms

0610039J17Rik, Sqrdl, flavo-binding protein, 4930557M22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122765237-122809569 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122807594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 139 (D139G)

Ref Sequence

ENSEMBL: ENSMUSP00000135786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005953] [ENSMUST00000110506] [ENSMUST00000126403] [ENSMUST00000176343]

AlphaFold

Q9R112

Predicted Effect

probably benign
Transcript: ENSMUST00000005953
AA Change: D357G

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000005953
Gene: ENSMUSG00000005803
AA Change: D357G

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	44	189	1.7e-11	PFAM
SCOP:d1fcda1	240	364	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110506
AA Change: D357G

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000106133
Gene: ENSMUSG00000005803
AA Change: D357G

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	45	342	7e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126403
AA Change: I296V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000117575
Gene: ENSMUSG00000005803
AA Change: I296V

Domain	Start	End	E-Value	Type
Pfam:Pyr_redox_2	45	192	8.3e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176343
AA Change: D139G

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135786
Gene: ENSMUSG00000005803
AA Change: D139G

Domain	Start	End	E-Value	Type
SCOP:d1fl2a1	25	132	6e-8	SMART

Meta Mutation Damage Score

0.5109

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Sqor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Sqor	APN	2	122787543	missense	probably damaging	0.97
IGL01544:Sqor	APN	2	122792346	splice site	probably benign
IGL02499:Sqor	APN	2	122808087	missense	possibly damaging	0.93
IGL02583:Sqor	APN	2	122799770	missense	probably damaging	0.98
IGL02732:Sqor	APN	2	122799762	missense	possibly damaging	0.76
IGL03137:Sqor	APN	2	122808071	missense	probably benign
H8786:Sqor	UTSW	2	122792368	missense	probably benign	0.10
R0126:Sqor	UTSW	2	122798027	unclassified	probably benign
R0410:Sqor	UTSW	2	122787522	missense	probably benign
R0502:Sqor	UTSW	2	122798050	missense	probably benign	0.04
R0709:Sqor	UTSW	2	122799855	missense	probably benign	0.38
R1486:Sqor	UTSW	2	122807645	splice site	probably null
R2001:Sqor	UTSW	2	122798098	missense	probably damaging	0.98
R2020:Sqor	UTSW	2	122804107	critical splice donor site	probably null
R2039:Sqor	UTSW	2	122792404	critical splice donor site	probably null
R2404:Sqor	UTSW	2	122808023	missense	probably benign
R4213:Sqor	UTSW	2	122787498	missense	probably damaging	1.00
R4909:Sqor	UTSW	2	122785181	missense	possibly damaging	0.82
R5630:Sqor	UTSW	2	122809357	missense	possibly damaging	0.71
R5659:Sqor	UTSW	2	122787603	missense	probably benign	0.02
R5728:Sqor	UTSW	2	122809400	makesense	probably null
R5772:Sqor	UTSW	2	122809341	missense	probably benign	0.00
R6527:Sqor	UTSW	2	122809286	missense	probably damaging	0.98
R6843:Sqor	UTSW	2	122784980	missense	probably benign	0.00
R6843:Sqor	UTSW	2	122809295	missense	probably damaging	0.99
R7193:Sqor	UTSW	2	122804009	missense	probably damaging	1.00
R7320:Sqor	UTSW	2	122799810	missense	probably benign
R7417:Sqor	UTSW	2	122787530	missense	probably benign	0.35
R7846:Sqor	UTSW	2	122785088	missense	probably benign	0.37
R8913:Sqor	UTSW	2	122799886	missense	probably benign
R8939:Sqor	UTSW	2	122807629	missense	possibly damaging	0.84
R9007:Sqor	UTSW	2	122807956	nonsense	probably null
R9030:Sqor	UTSW	2	122787594	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GAATTGAGGGCTCCTTCTGC -3'
(R):5'- AGCAAGAGAGGTATAGCCATCATAC -3'

Sequencing Primer
(F):5'- AGGGCTCCTTCTGCTAGTCAG -3'
(R):5'- GGTATAGCCATCATACTGAAATTGTG -3'

Posted On

2018-07-23