Incidental Mutation 'R6657:Pcsk2'
ID 526649
Institutional Source Beutler Lab
Gene Symbol Pcsk2
Ensembl Gene ENSMUSG00000027419
Gene Name proprotein convertase subtilisin/kexin type 2
Synonyms Phpp-2, SPC2, Nec2, PC2, Nec-2, prohormone convertase 2, 6330411F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 143546156-143816285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 143690366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 145 (L145V)
Ref Sequence ENSEMBL: ENSMUSP00000028905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028905]
AlphaFold P21661
Predicted Effect probably damaging
Transcript: ENSMUST00000028905
AA Change: L145V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028905
Gene: ENSMUSG00000027419
AA Change: L145V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:S8_pro-domain 32 108 2.9e-21 PFAM
Pfam:Peptidase_S8 157 444 5e-44 PFAM
Pfam:P_proprotein 503 590 4.3e-28 PFAM
low complexity region 617 630 N/A INTRINSIC
Meta Mutation Damage Score 0.1789 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The protein undergoes an initial autocatalytic processing event and interacts with a neuroendocrine secretory protein in the ER, exits the ER and sorts to secretory granules, where it is cleaved and catalytically activated during intracellular transport. The encoded protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in the maturation of peptide hormones leading to reduced female fertility, increased blood pressure on a high salt diet, and abnormal glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Pcsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcsk2 APN 2 143793239 missense probably damaging 1.00
IGL01609:Pcsk2 APN 2 143801158 missense possibly damaging 0.88
IGL01690:Pcsk2 APN 2 143687570 missense probably benign
IGL01833:Pcsk2 APN 2 143687580 missense possibly damaging 0.62
IGL01962:Pcsk2 APN 2 143813632 nonsense probably null
IGL02219:Pcsk2 APN 2 143793125 missense probably damaging 1.00
IGL02572:Pcsk2 APN 2 143690342 missense probably damaging 1.00
IGL02752:Pcsk2 APN 2 143773945 missense probably benign 0.09
P0035:Pcsk2 UTSW 2 143795951 missense probably damaging 1.00
R0092:Pcsk2 UTSW 2 143801024 missense probably damaging 1.00
R1424:Pcsk2 UTSW 2 143573428 splice site probably benign
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1832:Pcsk2 UTSW 2 143793269 missense probably damaging 1.00
R1993:Pcsk2 UTSW 2 143687619 missense probably benign 0.00
R4615:Pcsk2 UTSW 2 143795969 missense probably damaging 1.00
R4783:Pcsk2 UTSW 2 143687679 critical splice donor site probably null
R4796:Pcsk2 UTSW 2 143813425 missense probably benign 0.16
R4827:Pcsk2 UTSW 2 143801179 nonsense probably null
R5357:Pcsk2 UTSW 2 143573464 missense probably benign 0.00
R5413:Pcsk2 UTSW 2 143696700 splice site probably null
R5440:Pcsk2 UTSW 2 143546543 missense probably benign 0.22
R5546:Pcsk2 UTSW 2 143546560 missense probably benign 0.00
R5605:Pcsk2 UTSW 2 143749245 intron probably benign
R5821:Pcsk2 UTSW 2 143749115 splice site probably null
R5905:Pcsk2 UTSW 2 143749140 missense probably damaging 0.98
R6120:Pcsk2 UTSW 2 143801111 missense probably damaging 1.00
R6135:Pcsk2 UTSW 2 143573540 missense possibly damaging 0.63
R6925:Pcsk2 UTSW 2 143813747 missense probably damaging 1.00
R7223:Pcsk2 UTSW 2 143690333 missense possibly damaging 0.95
R7289:Pcsk2 UTSW 2 143690423 missense probably damaging 1.00
R8043:Pcsk2 UTSW 2 143813530 nonsense probably null
R8803:Pcsk2 UTSW 2 143795950 missense probably damaging 0.99
R8819:Pcsk2 UTSW 2 143801070 missense probably damaging 0.99
R8820:Pcsk2 UTSW 2 143801070 missense probably damaging 0.99
R9131:Pcsk2 UTSW 2 143813663 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCAGCAATTTAGTTATGAGATGAGG -3'
(R):5'- TGGCCATCAGGTCCAGTATC -3'

Sequencing Primer
(F):5'- ATGAGGGGATTAGAGCAGTATTTG -3'
(R):5'- GCCATCAGGTCCAGTATCAGAATTG -3'
Posted On 2018-07-23