Incidental Mutation 'R6657:Mmp24'
ID 526651
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Name matrix metallopeptidase 24
Synonyms Membrane type 5-MMP, MT5-MMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155775342-155818366 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155798179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 143 (Y143F)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141]
AlphaFold Q9R0S2
Predicted Effect probably damaging
Transcript: ENSMUST00000029141
AA Change: Y143F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: Y143F

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155799887 missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155812293 missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155815788 missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155792597 missense probably benign 0.01
R1381:Mmp24 UTSW 2 155814127 missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4498:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155815899 missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155814096 missense probably damaging 0.99
R5020:Mmp24 UTSW 2 155810284 missense probably benign 0.09
R5501:Mmp24 UTSW 2 155798136 missense probably damaging 1.00
R5686:Mmp24 UTSW 2 155799777 missense probably damaging 0.99
R5709:Mmp24 UTSW 2 155792542 missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155799909 missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155815753 missense possibly damaging 0.67
R7015:Mmp24 UTSW 2 155792624 missense probably damaging 0.99
R7699:Mmp24 UTSW 2 155798176 missense probably damaging 0.99
R8076:Mmp24 UTSW 2 155807561 nonsense probably null
R8111:Mmp24 UTSW 2 155807425 missense possibly damaging 0.81
R8139:Mmp24 UTSW 2 155814045 nonsense probably null
R8304:Mmp24 UTSW 2 155799839 missense possibly damaging 0.85
R8344:Mmp24 UTSW 2 155810303 missense possibly damaging 0.68
R8411:Mmp24 UTSW 2 155814015 missense probably benign 0.03
R8527:Mmp24 UTSW 2 155799714 missense probably benign 0.02
R8542:Mmp24 UTSW 2 155799714 missense probably benign 0.02
R9198:Mmp24 UTSW 2 155798121 missense probably benign 0.19
Z1176:Mmp24 UTSW 2 155810392 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTGTCTTAGAGTGCTCAGTAAC -3'
(R):5'- AAACCTGAGGGTGGAGTCAC -3'

Sequencing Primer
(F):5'- TGCTCAGTAACCACAGTGTG -3'
(R):5'- CAAGGAAGACAAGTTCACAGGCTC -3'
Posted On 2018-07-23