Mutagenetix > Incidental Mutation

Incidental Mutation 'R6657:Mroh7'

526652

Institutional Source

Beutler Lab

Gene Symbol

Mroh7

Ensembl Gene

ENSMUSG00000047502

Gene Name

maestro heat-like repeat family member 7

Synonyms

Heatr8, LOC381538, Gm1027

MMRRC Submission

044778-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106680417-106730925 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 106702500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 743 (C743*)

Ref Sequence

ENSEMBL: ENSMUSP00000102382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106770]

AlphaFold

A2AVR2

Predicted Effect

probably null
Transcript: ENSMUST00000106770
AA Change: C743*

SMART Domains

Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: C743*

Domain	Start	End	E-Value	Type
low complexity region	39	61	N/A	INTRINSIC
low complexity region	318	332	N/A	INTRINSIC
low complexity region	563	573	N/A	INTRINSIC
SCOP:d1b3ua_	634	1218	6e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145374

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Mroh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Mroh7	APN	4	106703161	missense	probably benign	0.00
IGL01729:Mroh7	APN	4	106704205	missense	possibly damaging	0.66
IGL01834:Mroh7	APN	4	106680874	missense	probably benign	0.00
IGL02003:Mroh7	APN	4	106702529	missense	probably damaging	0.96
IGL02135:Mroh7	APN	4	106702510	missense	probably damaging	1.00
IGL02335:Mroh7	APN	4	106707782	missense	probably damaging	1.00
IGL02532:Mroh7	APN	4	106720591	missense	probably benign	0.04
IGL02896:Mroh7	APN	4	106699816	missense	possibly damaging	0.94
IGL03066:Mroh7	APN	4	106692398	missense	possibly damaging	0.85
IGL03298:Mroh7	APN	4	106714091	nonsense	probably null
holy	UTSW	4	106709955	splice site	probably null
moley	UTSW	4	106694312	splice site	probably null
P0016:Mroh7	UTSW	4	106707857	critical splice acceptor site	probably null
R0019:Mroh7	UTSW	4	106721426	missense	probably benign	0.07
R0094:Mroh7	UTSW	4	106703184	missense	probably damaging	0.98
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0515:Mroh7	UTSW	4	106691664	missense	probably benign	0.01
R0828:Mroh7	UTSW	4	106699876	missense	probably damaging	0.99
R0831:Mroh7	UTSW	4	106680793	missense	possibly damaging	0.92
R1107:Mroh7	UTSW	4	106707594	splice site	probably null
R1301:Mroh7	UTSW	4	106720495	missense	probably damaging	0.99
R1456:Mroh7	UTSW	4	106695141	splice site	probably benign
R1491:Mroh7	UTSW	4	106703058	missense	probably benign	0.11
R1540:Mroh7	UTSW	4	106703076	missense	probably benign	0.11
R1560:Mroh7	UTSW	4	106711254	missense	possibly damaging	0.78
R1645:Mroh7	UTSW	4	106720668	missense	probably benign	0.19
R1804:Mroh7	UTSW	4	106694392	missense	possibly damaging	0.76
R2162:Mroh7	UTSW	4	106700181	missense	probably damaging	0.96
R2265:Mroh7	UTSW	4	106720927	missense	probably benign	0.01
R2866:Mroh7	UTSW	4	106691090	missense	probably damaging	1.00
R3716:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R3718:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R4530:Mroh7	UTSW	4	106720437	missense	possibly damaging	0.71
R4661:Mroh7	UTSW	4	106691513	critical splice donor site	probably null
R4706:Mroh7	UTSW	4	106691624	missense	possibly damaging	0.86
R4910:Mroh7	UTSW	4	106709955	splice site	probably null
R4965:Mroh7	UTSW	4	106690987	missense	possibly damaging	0.77
R4969:Mroh7	UTSW	4	106680873	missense	probably benign
R4971:Mroh7	UTSW	4	106691552	missense	probably benign	0.04
R5083:Mroh7	UTSW	4	106690318	missense	probably benign	0.03
R5207:Mroh7	UTSW	4	106721386	missense	probably damaging	0.97
R5364:Mroh7	UTSW	4	106691643	missense	probably benign	0.10
R5392:Mroh7	UTSW	4	106711251	critical splice donor site	probably null
R5630:Mroh7	UTSW	4	106720567	missense	possibly damaging	0.71
R5691:Mroh7	UTSW	4	106702618	missense	probably damaging	0.96
R5703:Mroh7	UTSW	4	106708560	missense	possibly damaging	0.77
R5707:Mroh7	UTSW	4	106681885	missense	possibly damaging	0.73
R5919:Mroh7	UTSW	4	106694312	splice site	probably null
R5979:Mroh7	UTSW	4	106720926	missense	probably benign	0.00
R6479:Mroh7	UTSW	4	106703188	missense	possibly damaging	0.75
R6520:Mroh7	UTSW	4	106721263	missense	probably benign	0.00
R6732:Mroh7	UTSW	4	106680713	frame shift	probably null
R6817:Mroh7	UTSW	4	106714115	missense	probably benign	0.00
R6980:Mroh7	UTSW	4	106700237	missense	probably benign	0.05
R7062:Mroh7	UTSW	4	106683980	missense	probably damaging	1.00
R7116:Mroh7	UTSW	4	106711320	missense	probably benign	0.07
R7134:Mroh7	UTSW	4	106720594	missense	probably damaging	0.99
R7169:Mroh7	UTSW	4	106691639	missense	probably damaging	0.99
R7419:Mroh7	UTSW	4	106683918	missense	probably benign
R7516:Mroh7	UTSW	4	106691119	missense	probably benign	0.00
R7525:Mroh7	UTSW	4	106709702	missense	probably benign	0.22
R7540:Mroh7	UTSW	4	106720398	missense	possibly damaging	0.85
R7849:Mroh7	UTSW	4	106721090	missense	probably benign
R7920:Mroh7	UTSW	4	106707576	missense	probably benign
R7998:Mroh7	UTSW	4	106711281	missense	probably benign	0.02
R8026:Mroh7	UTSW	4	106721437	missense	probably benign	0.01
R8122:Mroh7	UTSW	4	106702529	missense	probably damaging	0.96
R8249:Mroh7	UTSW	4	106721212	missense	probably benign	0.00
R9188:Mroh7	UTSW	4	106709592	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCAGTACAGATCCAGCGGTG -3'
(R):5'- CTGGTTACTCTACCGTAAGTCC -3'

Sequencing Primer
(F):5'- TACAGATCCAGCGGTGTTGAG -3'
(R):5'- GGTTACTCTACCGTAAGTCCTTCTC -3'

Posted On

2018-07-23