Incidental Mutation 'R6657:Rsrc2'
ID 526654
Institutional Source Beutler Lab
Gene Symbol Rsrc2
Ensembl Gene ENSMUSG00000029422
Gene Name arginine/serine-rich coiled-coil 2
Synonyms 1500011J06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123728426-123749414 bp(-) (GRCm38)
Type of Mutation utr 5 prime
DNA Base Change (assembly) A to G at 123739567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050827] [ENSMUST00000057795] [ENSMUST00000111515] [ENSMUST00000182015] [ENSMUST00000182093] [ENSMUST00000182241] [ENSMUST00000182309] [ENSMUST00000182411] [ENSMUST00000182489] [ENSMUST00000182556] [ENSMUST00000182955] [ENSMUST00000183147]
AlphaFold A2RTL5
Predicted Effect unknown
Transcript: ENSMUST00000050827
AA Change: I117T
SMART Domains Protein: ENSMUSP00000050563
Gene: ENSMUSG00000029422
AA Change: I117T

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
low complexity region 108 208 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
coiled coil region 228 272 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
Pfam:SMAP 354 423 6.7e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000057795
AA Change: I117T
SMART Domains Protein: ENSMUSP00000049942
Gene: ENSMUSG00000029422
AA Change: I117T

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
coiled coil region 170 214 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
Pfam:SMAP 295 365 4.7e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111515
AA Change: I117T
SMART Domains Protein: ENSMUSP00000107140
Gene: ENSMUSG00000029422
AA Change: I117T

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181980
Predicted Effect probably benign
Transcript: ENSMUST00000182015
SMART Domains Protein: ENSMUSP00000138210
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 36 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182093
Predicted Effect probably benign
Transcript: ENSMUST00000182241
SMART Domains Protein: ENSMUSP00000138162
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 36 69 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182309
AA Change: I175T
SMART Domains Protein: ENSMUSP00000138691
Gene: ENSMUSG00000029422
AA Change: I175T

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
low complexity region 108 208 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
coiled coil region 228 272 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
Pfam:SMAP 353 423 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182411
SMART Domains Protein: ENSMUSP00000138439
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182489
AA Change: I128T
SMART Domains Protein: ENSMUSP00000138518
Gene: ENSMUSG00000029422
AA Change: I128T

DomainStartEndE-ValueType
internal_repeat_1 10 46 8.8e-5 PROSPERO
low complexity region 61 161 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
coiled coil region 181 225 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
Pfam:SMAP 306 376 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182542
Predicted Effect unknown
Transcript: ENSMUST00000182556
AA Change: I117T
SMART Domains Protein: ENSMUSP00000138631
Gene: ENSMUSG00000029422
AA Change: I117T

DomainStartEndE-ValueType
low complexity region 50 150 N/A INTRINSIC
low complexity region 151 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182809
Predicted Effect probably benign
Transcript: ENSMUST00000182861
Predicted Effect probably benign
Transcript: ENSMUST00000182955
SMART Domains Protein: ENSMUSP00000138280
Gene: ENSMUSG00000029422

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
Pfam:SMAP 122 192 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182948
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Rsrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Rsrc2 APN 5 123739622 utr 5 prime probably benign
IGL03268:Rsrc2 APN 5 123740727 nonsense probably null
PIT4519001:Rsrc2 UTSW 5 123745072 missense unknown
R0254:Rsrc2 UTSW 5 123740847 utr 5 prime probably benign
R2889:Rsrc2 UTSW 5 123736557 critical splice donor site probably benign
R3875:Rsrc2 UTSW 5 123736628 utr 5 prime probably benign
R4914:Rsrc2 UTSW 5 123739550 utr 5 prime probably benign
R5200:Rsrc2 UTSW 5 123739499 nonsense probably null
R5237:Rsrc2 UTSW 5 123739582 utr 5 prime probably benign
R5473:Rsrc2 UTSW 5 123731087 missense probably damaging 1.00
R6263:Rsrc2 UTSW 5 123739688 start gained probably benign
R6806:Rsrc2 UTSW 5 123739531 utr 5 prime probably benign
R7145:Rsrc2 UTSW 5 123739567 utr 5 prime probably benign
R8894:Rsrc2 UTSW 5 123740730 missense unknown
X0020:Rsrc2 UTSW 5 123729223 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTAAAGCACGCTCACTGAG -3'
(R):5'- TAGAGGCGAAGAAAGCTCCC -3'

Sequencing Primer
(F):5'- GCTCACTGAGACAACAACTAGG -3'
(R):5'- GTAGCAAGAACCTGTGCTATCTG -3'
Posted On 2018-07-23