Incidental Mutation 'R6657:Akr1b3'
ID526656
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6657 (G1)
Quality Score220.009
Status Validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34310004 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 206 (V206M)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102980
AA Change: V206M

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V206M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGAAGAATATCCATCTTGTTCC -3'
(R):5'- GCCATCAACTGGGAAATGTGG -3'

Sequencing Primer
(F):5'- TTCCTAGGAACATCAACCTCCCAG -3'
(R):5'- GGGGGAGTTGTTACAGCTTATC -3'
Posted On2018-07-23