Incidental Mutation 'R6657:Akr1b7'
ID 526657
Institutional Source Beutler Lab
Gene Symbol Akr1b7
Ensembl Gene ENSMUSG00000052131
Gene Name aldo-keto reductase family 1, member B7
Synonyms Avdp, MVDP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34412334-34423142 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34416200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 106 (D106A)
Ref Sequence ENSEMBL: ENSMUSP00000007449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007449]
AlphaFold P21300
Predicted Effect probably damaging
Transcript: ENSMUST00000007449
AA Change: D106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007449
Gene: ENSMUSG00000052131
AA Change: D106A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 294 2.1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155560
Meta Mutation Damage Score 0.8893 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit disrupted progesterone levels during estrous. Mice homozygous for a different knock-out allele exhibit increased basal adiposity and susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Akr1b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Akr1b7 APN 6 34421117 missense possibly damaging 0.96
IGL02006:Akr1b7 APN 6 34415450 missense probably benign 0.03
IGL02238:Akr1b7 APN 6 34415398 missense probably damaging 1.00
R0393:Akr1b7 UTSW 6 34415400 nonsense probably null
R1809:Akr1b7 UTSW 6 34419111 missense probably damaging 1.00
R2114:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R2115:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R2117:Akr1b7 UTSW 6 34418994 missense possibly damaging 0.71
R4277:Akr1b7 UTSW 6 34421020 intron probably benign
R5396:Akr1b7 UTSW 6 34412476 critical splice donor site probably null
R5504:Akr1b7 UTSW 6 34419518 splice site probably null
R6181:Akr1b7 UTSW 6 34415378 missense possibly damaging 0.71
R6815:Akr1b7 UTSW 6 34412334 splice site probably null
R7211:Akr1b7 UTSW 6 34421114 missense probably benign 0.39
R7246:Akr1b7 UTSW 6 34415469 missense probably benign 0.04
R7417:Akr1b7 UTSW 6 34417365 splice site probably null
R7572:Akr1b7 UTSW 6 34419408 missense probably damaging 0.99
R7608:Akr1b7 UTSW 6 34420522 missense probably damaging 1.00
R9068:Akr1b7 UTSW 6 34419042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTACAAATCTCCAAGCAG -3'
(R):5'- AAGTACCACCTGTTGCCTCAG -3'

Sequencing Primer
(F):5'- CAGGAGGAGTAACTGTAGTATGTGTG -3'
(R):5'- CACAGTCTTCTGGGGACTAGAG -3'
Posted On 2018-07-23