Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Pdzrn3'

526659

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn3

Ensembl Gene

ENSMUSG00000035357

Gene Name

PDZ domain containing RING finger 3

Synonyms

LNX3, semaphorin cytoplasmic domain-associated protein 3A, Semcap3, 1110020C07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.624) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101149609-101377897 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 101151022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 894 (Q894H)

Ref Sequence

ENSEMBL: ENSMUSP00000075376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075994]

AlphaFold

Q69ZS0

Predicted Effect

probably benign
Transcript: ENSMUST00000075994
AA Change: Q894H

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000075376
Gene: ENSMUSG00000035357
AA Change: Q894H

Domain	Start	End	E-Value	Type
RING	18	55	3.93e-3	SMART
low complexity region	198	214	N/A	INTRINSIC
PDZ	257	339	3.38e-21	SMART
PDZ	429	504	3.86e-16	SMART
low complexity region	512	526	N/A	INTRINSIC
low complexity region	660	671	N/A	INTRINSIC
low complexity region	1020	1029	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205008

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LNX (Ligand of Numb Protein-X) family of RING-type ubiquitin E3 ligases. This protein may function in vascular morphogenesis and the differentiation of adipocytes, osteoblasts and myoblasts. This protein may be targeted for degradation by the human papilloma virus E6 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Washc4	T	A	10: 83,558,618	F269L	possibly damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Pdzrn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Pdzrn3	APN	6	101354486	missense	probably benign	0.01
IGL01511:Pdzrn3	APN	6	101153256	missense	possibly damaging	0.66
IGL01554:Pdzrn3	APN	6	101150541	missense	probably damaging	1.00
IGL02450:Pdzrn3	APN	6	101354500	missense	probably damaging	1.00
IGL02505:Pdzrn3	APN	6	101151938	missense	possibly damaging	0.94
IGL03061:Pdzrn3	APN	6	101151855	missense	probably damaging	1.00
IGL03210:Pdzrn3	APN	6	101156952	missense	possibly damaging	0.95
gefilte	UTSW	6	101154192	critical splice donor site	probably null
implevit_bonis	UTSW	6	101151022	missense	probably benign	0.15
predisposition	UTSW	6	101151053	missense	probably damaging	1.00
tendency	UTSW	6	101151428	missense	probably damaging	1.00
PIT4581001:Pdzrn3	UTSW	6	101151503	missense	probably benign	0.00
R0110:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0469:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0496:Pdzrn3	UTSW	6	101150570	missense	possibly damaging	0.94
R0510:Pdzrn3	UTSW	6	101151053	missense	probably damaging	1.00
R0883:Pdzrn3	UTSW	6	101155942	splice site	probably null
R1171:Pdzrn3	UTSW	6	101150877	missense	probably damaging	1.00
R1471:Pdzrn3	UTSW	6	101151512	missense	possibly damaging	0.77
R1496:Pdzrn3	UTSW	6	101150969	missense	probably benign	0.00
R1596:Pdzrn3	UTSW	6	101151005	missense	probably benign	0.03
R2033:Pdzrn3	UTSW	6	101150954	missense	probably damaging	1.00
R2068:Pdzrn3	UTSW	6	101150699	missense	probably damaging	1.00
R2084:Pdzrn3	UTSW	6	101154295	missense	probably benign	0.35
R2432:Pdzrn3	UTSW	6	101150791	missense	probably damaging	1.00
R3727:Pdzrn3	UTSW	6	101156945	missense	probably damaging	0.98
R3861:Pdzrn3	UTSW	6	101172371	missense	possibly damaging	0.95
R4616:Pdzrn3	UTSW	6	101152009	missense	probably damaging	0.99
R4967:Pdzrn3	UTSW	6	101151590	missense	probably damaging	1.00
R5224:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5226:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5227:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5230:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5320:Pdzrn3	UTSW	6	101151103	missense	probably damaging	1.00
R5414:Pdzrn3	UTSW	6	101153311	missense	probably damaging	1.00
R5686:Pdzrn3	UTSW	6	101151428	missense	probably damaging	1.00
R5772:Pdzrn3	UTSW	6	101172314	missense	probably benign	0.00
R6026:Pdzrn3	UTSW	6	101362144	missense	probably benign	0.40
R6213:Pdzrn3	UTSW	6	101377844	missense	probably damaging	1.00
R6518:Pdzrn3	UTSW	6	101150514	makesense	probably null
R6951:Pdzrn3	UTSW	6	101154192	critical splice donor site	probably null
R7055:Pdzrn3	UTSW	6	101151774	nonsense	probably null
R7290:Pdzrn3	UTSW	6	101151245	missense	probably benign
R7608:Pdzrn3	UTSW	6	101151752	missense	probably damaging	1.00
R7834:Pdzrn3	UTSW	6	101151195	missense	probably damaging	0.97
R8199:Pdzrn3	UTSW	6	101151957	missense	probably damaging	1.00
R8338:Pdzrn3	UTSW	6	101150822	missense	probably benign	0.00
R8734:Pdzrn3	UTSW	6	101151606	missense	probably damaging	0.98
R8783:Pdzrn3	UTSW	6	101155880	missense	probably damaging	1.00
R9082:Pdzrn3	UTSW	6	101169133	critical splice donor site	probably null
R9378:Pdzrn3	UTSW	6	101150811	missense	probably damaging	1.00
Z1176:Pdzrn3	UTSW	6	101151999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAGCGCCCCATCTTCATC -3'
(R):5'- TTTGGAGATCAAAGAACGCCG -3'

Sequencing Primer
(F):5'- ATGGCGTCATCATCCGTG -3'
(R):5'- TCAAAGAACGCCGAGGTAGC -3'

Posted On

2018-07-23