Incidental Mutation 'R6657:Bhlhe40'
ID 526660
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms Stra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5
MMRRC Submission
Accession Numbers

Genbank: NM_011498; MGI: 1097714

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6657 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108660629-108666925 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108664857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108661178 missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108664940 missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108664542 missense probably damaging 1.00
teedoff UTSW 6 108664857 frame shift probably null
R0360:Bhlhe40 UTSW 6 108664750 missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108664929 missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108662585 missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108665208 missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108665193 missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108664462 splice site probably null
R6283:Bhlhe40 UTSW 6 108665031 missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6406:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6595:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6654:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6656:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6659:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6734:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6968:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7105:Bhlhe40 UTSW 6 108665036 missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108665281 missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7399:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7472:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7563:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7726:Bhlhe40 UTSW 6 108662598 missense probably benign
R8058:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8319:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8320:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8380:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8381:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8428:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8431:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8432:Bhlhe40 UTSW 6 108664857 frame shift probably null
R8988:Bhlhe40 UTSW 6 108662557 missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108665283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-07-23