Incidental Mutation 'R6657:Bhlhe40'
ID 526660
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044778-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6657 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 106,435,450 (GRCm39) L36R probably damaging Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Akr1b7 A C 6: 34,393,135 (GRCm39) D106A probably damaging Het
Chst5 C T 8: 112,616,906 (GRCm39) R238Q probably benign Het
Cpxm2 T C 7: 131,650,806 (GRCm39) Y618C probably damaging Het
Csnk1d T C 11: 120,855,820 (GRCm39) E405G possibly damaging Het
Ctsh A T 9: 89,942,555 (GRCm39) M37L probably benign Het
Eml5 T G 12: 98,757,664 (GRCm39) I1843L probably damaging Het
Ep400 C A 5: 110,841,411 (GRCm39) probably benign Het
Fbln2 A G 6: 91,236,732 (GRCm39) N749S possibly damaging Het
Gpc5 A G 14: 115,607,610 (GRCm39) H404R probably benign Het
Hyal6 A G 6: 24,734,757 (GRCm39) D230G possibly damaging Het
Itga5 T C 15: 103,259,222 (GRCm39) D735G probably damaging Het
Kansl2 T A 15: 98,422,551 (GRCm39) Q339L possibly damaging Het
Lrp4 T A 2: 91,322,398 (GRCm39) M1078K probably benign Het
Mmp24 A T 2: 155,640,099 (GRCm39) Y143F probably damaging Het
Mroh7 A T 4: 106,559,697 (GRCm39) C743* probably null Het
Myh14 T C 7: 44,287,270 (GRCm39) N618D probably damaging Het
Myo19 A T 11: 84,788,022 (GRCm39) M324L probably benign Het
Nectin2 T C 7: 19,472,065 (GRCm39) N108S probably benign Het
Nrg2 A G 18: 36,329,642 (GRCm39) I191T probably damaging Het
Odf4 T C 11: 68,817,638 (GRCm39) N18D probably benign Het
Or5aq6 T A 2: 86,923,403 (GRCm39) I113F probably benign Het
Pcsk2 T G 2: 143,532,286 (GRCm39) L145V probably damaging Het
Pdzrn3 C A 6: 101,127,983 (GRCm39) Q894H probably benign Het
Pfpl G A 19: 12,407,290 (GRCm39) V514I probably benign Het
Plbd1 A T 6: 136,594,250 (GRCm39) M333K probably damaging Het
Plec A T 15: 76,062,356 (GRCm39) M2554K possibly damaging Het
Psmb5 A G 14: 54,851,840 (GRCm39) Y115H possibly damaging Het
Rictor A G 15: 6,788,977 (GRCm39) N198D possibly damaging Het
Rsrc2 A G 5: 123,877,630 (GRCm39) probably benign Het
Sec16a C T 2: 26,315,876 (GRCm39) W262* probably null Het
Sfmbt1 A G 14: 30,488,053 (GRCm39) D8G possibly damaging Het
Sptbn5 T G 2: 119,906,881 (GRCm39) probably benign Het
Sqor A G 2: 122,649,514 (GRCm39) D139G possibly damaging Het
Sugt1 A T 14: 79,844,701 (GRCm39) T139S probably benign Het
Tcp11 G A 17: 28,290,646 (GRCm39) P159S probably damaging Het
Tmem262 A G 19: 6,130,542 (GRCm39) T89A possibly damaging Het
Tnfaip6 C A 2: 51,933,795 (GRCm39) T50N probably damaging Het
Ttll9 T C 2: 152,826,182 (GRCm39) Y131H probably damaging Het
Vmn1r173 T A 7: 23,402,320 (GRCm39) M185K probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r52 G A 7: 9,893,090 (GRCm39) T683I probably damaging Het
Vps53 A T 11: 76,025,253 (GRCm39) I197N probably damaging Het
Washc4 T A 10: 83,394,482 (GRCm39) F269L possibly damaging Het
Wdfy4 C T 14: 32,769,208 (GRCm39) V2086M possibly damaging Het
Zfp592 A T 7: 80,675,234 (GRCm39) T733S possibly damaging Het
Zfp599 A G 9: 22,161,538 (GRCm39) F209S probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-07-23