Incidental Mutation 'R6657:Nectin2'
ID 526663
Institutional Source Beutler Lab
Gene Symbol Nectin2
Ensembl Gene ENSMUSG00000062300
Gene Name nectin cell adhesion molecule 2
Synonyms MPH, nectin-2, Cd112, Pvs, Pvrl2
MMRRC Submission 044778-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 19716644-19750483 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19738140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 108 (N108S)
Ref Sequence ENSEMBL: ENSMUSP00000104089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075447] [ENSMUST00000108450]
AlphaFold P32507
Predicted Effect probably benign
Transcript: ENSMUST00000075447
AA Change: N108S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300
AA Change: N108S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108450
AA Change: N108S

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104089
Gene: ENSMUSG00000062300
AA Change: N108S

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 416 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207271
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations exhibit male sterility associated with sperm head and midpiece malformation, impaired zona binding, and lack of oocyte penetration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Nectin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Nectin2 APN 7 19717562 missense probably damaging 1.00
IGL03184:Nectin2 APN 7 19738306 missense possibly damaging 0.86
PIT4458001:Nectin2 UTSW 7 19738327 missense probably benign 0.19
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0555:Nectin2 UTSW 7 19733223 splice site probably benign
R0764:Nectin2 UTSW 7 19749171 splice site probably null
R1252:Nectin2 UTSW 7 19717598 missense probably benign 0.18
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1833:Nectin2 UTSW 7 19717708 missense probably damaging 0.96
R2115:Nectin2 UTSW 7 19717564 missense probably damaging 0.98
R2168:Nectin2 UTSW 7 19730614 missense probably damaging 0.98
R3801:Nectin2 UTSW 7 19717636 missense probably benign
R3825:Nectin2 UTSW 7 19724585 missense possibly damaging 0.94
R4877:Nectin2 UTSW 7 19717720 missense possibly damaging 0.55
R5062:Nectin2 UTSW 7 19738273 missense probably benign 0.09
R5082:Nectin2 UTSW 7 19738124 missense probably damaging 0.99
R5693:Nectin2 UTSW 7 19724869 missense probably benign 0.00
R6042:Nectin2 UTSW 7 19738138 missense probably benign 0.01
R6060:Nectin2 UTSW 7 19717775 missense probably damaging 1.00
R7437:Nectin2 UTSW 7 19749268 nonsense probably null
R7476:Nectin2 UTSW 7 19717621 missense possibly damaging 0.82
R7523:Nectin2 UTSW 7 19730112 missense probably benign 0.00
R7538:Nectin2 UTSW 7 19730619 missense probably damaging 1.00
R7910:Nectin2 UTSW 7 19732987 nonsense probably null
R8181:Nectin2 UTSW 7 19724808 missense probably damaging 1.00
R8394:Nectin2 UTSW 7 19733212 critical splice acceptor site probably null
R8406:Nectin2 UTSW 7 19738350 missense probably damaging 0.99
R8419:Nectin2 UTSW 7 19717721 missense probably benign 0.00
R8419:Nectin2 UTSW 7 19738078 missense probably damaging 1.00
R9188:Nectin2 UTSW 7 19719194 critical splice donor site probably null
Z1176:Nectin2 UTSW 7 19738363 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACCTGAAAGCTAGGACACGG -3'
(R):5'- GAGATCTCTGGCTTGTTCCC -3'

Sequencing Primer
(F):5'- GAGAAATAGCCAGGGTTCCCTC -3'
(R):5'- TACGAGTGCTTCCCGAGGTC -3'
Posted On 2018-07-23