Incidental Mutation 'R6657:4933405L10Rik'
ID 526668
Institutional Source Beutler Lab
Gene Symbol 4933405L10Rik
Ensembl Gene ENSMUSG00000013158
Gene Name RIKEN cDNA 4933405L10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105707655-105710246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 105708818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 36 (L36R)
Ref Sequence ENSEMBL: ENSMUSP00000148838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000013302] [ENSMUST00000211852] [ENSMUST00000212061]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000013299
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000013302
AA Change: L36R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013302
Gene: ENSMUSG00000013158
AA Change: L36R

DomainStartEndE-ValueType
Pfam:DUF4691 1 162 3.3e-71 PFAM
low complexity region 200 216 N/A INTRINSIC
low complexity region 252 275 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211852
AA Change: L36R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212716
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in 4933405L10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:4933405L10Rik APN 8 105710036 missense probably damaging 0.98
IGL01845:4933405L10Rik APN 8 105708935 missense probably benign
R0096:4933405L10Rik UTSW 8 105708931 splice site probably null
R0096:4933405L10Rik UTSW 8 105708931 splice site probably null
R0396:4933405L10Rik UTSW 8 105709780 missense probably benign 0.06
R0711:4933405L10Rik UTSW 8 105708931 splice site probably null
R1037:4933405L10Rik UTSW 8 105709512 missense probably benign 0.32
R1816:4933405L10Rik UTSW 8 105709859 missense possibly damaging 0.50
R1843:4933405L10Rik UTSW 8 105708974 missense probably damaging 0.98
R4332:4933405L10Rik UTSW 8 105709724 missense possibly damaging 0.92
R4868:4933405L10Rik UTSW 8 105710097 makesense probably null
R5072:4933405L10Rik UTSW 8 105709569 missense possibly damaging 0.71
R5285:4933405L10Rik UTSW 8 105708465 missense probably benign
R5656:4933405L10Rik UTSW 8 105709512 missense probably benign 0.32
R6196:4933405L10Rik UTSW 8 105709922 missense possibly damaging 0.92
R6524:4933405L10Rik UTSW 8 105709009 missense possibly damaging 0.71
Z1088:4933405L10Rik UTSW 8 105709763 missense probably damaging 1.00
Z1177:4933405L10Rik UTSW 8 105709973 missense possibly damaging 0.91
Z1177:4933405L10Rik UTSW 8 105709975 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTACAAGTAGAGAGGCCTAAGCTG -3'
(R):5'- TTTCTCTTGGGCCCATGAGC -3'

Sequencing Primer
(F):5'- AGAGGCCTAAGCTGGTTACCTTC -3'
(R):5'- AGCTGGTCTCACGATGGATGAC -3'
Posted On 2018-07-23