Incidental Mutation 'R6657:Chst5'
ID526669
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Namecarbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
SynonymsGST-4, I-GlcNAc6ST
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6657 (G1)
Quality Score93.0077
Status Validated
Chromosome8
Chromosomal Location111889136-111910447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111890274 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 238 (R238Q)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
Predicted Effect probably benign
Transcript: ENSMUST00000034430
AA Change: R238Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: R238Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 111890682 missense probably damaging 1.00
IGL02336:Chst5 APN 8 111890317 missense probably damaging 0.99
IGL02634:Chst5 APN 8 111890845 missense probably damaging 1.00
R0606:Chst5 UTSW 8 111890919 missense probably benign 0.05
R1552:Chst5 UTSW 8 111890280 missense probably damaging 0.99
R2094:Chst5 UTSW 8 111890544 missense probably benign 0.01
R3769:Chst5 UTSW 8 111889881 missense possibly damaging 0.67
R4135:Chst5 UTSW 8 111890184 missense probably damaging 1.00
R4872:Chst5 UTSW 8 111890560 missense possibly damaging 0.61
R5658:Chst5 UTSW 8 111890790 missense probably damaging 1.00
R5759:Chst5 UTSW 8 111890210 missense probably benign 0.25
R5893:Chst5 UTSW 8 111890196 missense probably damaging 1.00
R6731:Chst5 UTSW 8 111890044 missense probably benign 0.00
R7406:Chst5 UTSW 8 111890613 missense probably benign 0.00
R7535:Chst5 UTSW 8 111890163 missense probably damaging 1.00
R7727:Chst5 UTSW 8 111890925 missense probably benign 0.25
R7835:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7843:Chst5 UTSW 8 111890572 missense probably benign 0.00
R7918:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7926:Chst5 UTSW 8 111890572 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTGATATTGTGGATCCAAGTC -3'
(R):5'- GAGGTGCGCTTCTTTAACCTAC -3'

Sequencing Primer
(F):5'- AAGTCTGGAGCTGCGGC -3'
(R):5'- GCATCGTGCACCTAGTG -3'
Posted On2018-07-23