Incidental Mutation 'R6657:Zfp599'
ID 526670
Institutional Source Beutler Lab
Gene Symbol Zfp599
Ensembl Gene ENSMUSG00000062794
Gene Name zinc finger protein 599
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22247430-22259895 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22250242 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 209 (F209S)
Ref Sequence ENSEMBL: ENSMUSP00000083462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086281]
AlphaFold E9PWP1
Predicted Effect probably damaging
Transcript: ENSMUST00000086281
AA Change: F209S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083462
Gene: ENSMUSG00000062794
AA Change: F209S

DomainStartEndE-ValueType
KRAB 4 64 5.35e-33 SMART
ZnF_C2H2 228 250 5.59e-4 SMART
ZnF_C2H2 256 278 2.43e-4 SMART
ZnF_C2H2 284 306 1.69e-3 SMART
ZnF_C2H2 312 334 8.94e-3 SMART
ZnF_C2H2 340 362 8.47e-4 SMART
ZnF_C2H2 368 390 5.06e-2 SMART
ZnF_C2H2 396 418 7.9e-4 SMART
ZnF_C2H2 424 446 7.67e-2 SMART
ZnF_C2H2 452 474 1.64e-1 SMART
ZnF_C2H2 480 503 7.37e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Other mutations in Zfp599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp599 APN 9 22249472 missense possibly damaging 0.94
IGL00845:Zfp599 APN 9 22251518 splice site probably benign
R0136:Zfp599 UTSW 9 22249742 missense probably benign 0.13
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0421:Zfp599 UTSW 9 22250547 splice site probably benign
R1699:Zfp599 UTSW 9 22250404 missense probably benign 0.20
R1723:Zfp599 UTSW 9 22258065 missense probably damaging 1.00
R1899:Zfp599 UTSW 9 22251549 missense probably benign 0.00
R4231:Zfp599 UTSW 9 22249745 nonsense probably null
R4233:Zfp599 UTSW 9 22249745 nonsense probably null
R4236:Zfp599 UTSW 9 22249745 nonsense probably null
R4931:Zfp599 UTSW 9 22258123 missense probably damaging 0.98
R5117:Zfp599 UTSW 9 22250100 nonsense probably null
R5615:Zfp599 UTSW 9 22253869 missense probably benign
R5759:Zfp599 UTSW 9 22249661 missense probably damaging 1.00
R5915:Zfp599 UTSW 9 22249834 missense probably damaging 1.00
R6184:Zfp599 UTSW 9 22249651 missense probably benign 0.18
R6188:Zfp599 UTSW 9 22249990 missense probably damaging 1.00
R6736:Zfp599 UTSW 9 22249844 missense probably damaging 1.00
R6752:Zfp599 UTSW 9 22249544 missense probably damaging 1.00
R7071:Zfp599 UTSW 9 22258096 missense probably benign 0.38
R7643:Zfp599 UTSW 9 22249892 missense probably benign 0.19
R7714:Zfp599 UTSW 9 22250515 missense probably benign 0.07
R7951:Zfp599 UTSW 9 22249468 missense probably damaging 1.00
R7967:Zfp599 UTSW 9 22249534 missense possibly damaging 0.66
R8014:Zfp599 UTSW 9 22249481 missense probably benign 0.03
R8187:Zfp599 UTSW 9 22249815 nonsense probably null
RF005:Zfp599 UTSW 9 22253884 missense probably benign 0.03
RF024:Zfp599 UTSW 9 22253884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGTGAGTTTTGATTTCTGGTAGAA -3'
(R):5'- TCTCCATTACACGGCAACTCT -3'

Sequencing Primer
(F):5'- GGTAGAAAGCTTTCCCACATTCAG -3'
(R):5'- GGCAACTCTCACTAAAGGTCAGAG -3'
Posted On 2018-07-23