Incidental Mutation 'R6657:Ctsh'
ID 526671
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Name cathepsin H
Synonyms Cat H
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 90054152-90076089 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90060502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 37 (M37L)
Ref Sequence ENSEMBL: ENSMUSP00000114427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000185459]
AlphaFold P49935
Predicted Effect probably benign
Transcript: ENSMUST00000034915
AA Change: M37L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359
AA Change: M37L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123320
AA Change: M37L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127842
Predicted Effect probably benign
Transcript: ENSMUST00000132718
AA Change: M63L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359
AA Change: M63L

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142750
Predicted Effect probably benign
Transcript: ENSMUST00000143172
AA Change: M37L

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359
AA Change: M37L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185459
AA Change: M34L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359
AA Change: M34L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190338
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 90064238 missense probably damaging 1.00
IGL01875:Ctsh APN 9 90064207 missense probably damaging 1.00
IGL02008:Ctsh APN 9 90061547 missense probably damaging 1.00
R0336:Ctsh UTSW 9 90075738 missense probably damaging 1.00
R0632:Ctsh UTSW 9 90061582 missense possibly damaging 0.82
R1488:Ctsh UTSW 9 90071891 missense possibly damaging 0.89
R1847:Ctsh UTSW 9 90061565 missense probably benign 0.04
R3613:Ctsh UTSW 9 90075710 missense probably damaging 1.00
R4270:Ctsh UTSW 9 90061598 missense probably damaging 0.99
R4860:Ctsh UTSW 9 90054548 missense probably benign 0.01
R5187:Ctsh UTSW 9 90054590 missense probably damaging 1.00
R5469:Ctsh UTSW 9 90060511 critical splice donor site probably null
R5900:Ctsh UTSW 9 90064568 missense probably damaging 1.00
R5937:Ctsh UTSW 9 90061456 missense probably benign
R6303:Ctsh UTSW 9 90062743 missense possibly damaging 0.83
R6905:Ctsh UTSW 9 90062766 missense probably damaging 1.00
R6985:Ctsh UTSW 9 90054604 missense possibly damaging 0.90
R7171:Ctsh UTSW 9 90067101 missense probably benign
R7342:Ctsh UTSW 9 90074987 missense probably benign
R7819:Ctsh UTSW 9 90060503 missense possibly damaging 0.71
R7884:Ctsh UTSW 9 90061423 missense probably benign
R8099:Ctsh UTSW 9 90064247 missense probably damaging 1.00
R8294:Ctsh UTSW 9 90068436 missense possibly damaging 0.74
R9195:Ctsh UTSW 9 90062762 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCGAACTCAAGCTTTAGATAACCC -3'
(R):5'- GGGCAGCACTATTTGGAAGG -3'

Sequencing Primer
(F):5'- AGACTACCGAGTGAGACTCTGTC -3'
(R):5'- AAGGTCACTTCACTGTCTCCTTC -3'
Posted On 2018-07-23