Mutagenetix > Incidental Mutations

Incidental Mutation 'R6657:Washc4'

526672

Institutional Source

Beutler Lab

Gene Symbol

Washc4

Ensembl Gene

ENSMUSG00000034560

Gene Name

WASH complex subunit 4

Synonyms

A230046K03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.763) question?

Stock #

R6657 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83543752-83596473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83558618 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 269 (F269L)

Ref Sequence

ENSEMBL: ENSMUSP00000039322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038388
AA Change: F269L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: F269L

Domain	Start	End	E-Value	Type
Pfam:WASH-7_N	32	604	4.8e-245	PFAM
Pfam:WASH-7_mid	605	949	7.9e-176	PFAM
low complexity region	954	965	N/A	INTRINSIC
Pfam:WASH-7_C	966	1135	9.1e-76	PFAM
low complexity region	1138	1156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217842

Meta Mutation Damage Score

0.1674

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 94.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	G	8: 105,708,818	L36R	probably damaging	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Akr1b7	A	C	6: 34,416,200	D106A	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Chst5	C	T	8: 111,890,274	R238Q	probably benign	Het
Cpxm2	T	C	7: 132,049,077	Y618C	probably damaging	Het
Csnk1d	T	C	11: 120,964,994	E405G	possibly damaging	Het
Ctsh	A	T	9: 90,060,502	M37L	probably benign	Het
Eml5	T	G	12: 98,791,405	I1843L	probably damaging	Het
Ep400	C	A	5: 110,693,545		probably benign	Het
Fbln2	A	G	6: 91,259,750	N749S	possibly damaging	Het
Gpc5	A	G	14: 115,370,198	H404R	probably benign	Het
Hyal6	A	G	6: 24,734,758	D230G	possibly damaging	Het
Itga5	T	C	15: 103,350,795	D735G	probably damaging	Het
Kansl2	T	A	15: 98,524,670	Q339L	possibly damaging	Het
Lrp4	T	A	2: 91,492,053	M1078K	probably benign	Het
Mmp24	A	T	2: 155,798,179	Y143F	probably damaging	Het
Mroh7	A	T	4: 106,702,500	C743*	probably null	Het
Myh14	T	C	7: 44,637,846	N618D	probably damaging	Het
Myo19	A	T	11: 84,897,196	M324L	probably benign	Het
Nectin2	T	C	7: 19,738,140	N108S	probably benign	Het
Nrg2	A	G	18: 36,196,589	I191T	probably damaging	Het
Odf4	T	C	11: 68,926,812	N18D	probably benign	Het
Olfr1109	T	A	2: 87,093,059	I113F	probably benign	Het
Pcsk2	T	G	2: 143,690,366	L145V	probably damaging	Het
Pdzrn3	C	A	6: 101,151,022	Q894H	probably benign	Het
Pfpl	G	A	19: 12,429,926	V514I	probably benign	Het
Plbd1	A	T	6: 136,617,252	M333K	probably damaging	Het
Plec	A	T	15: 76,178,156	M2554K	possibly damaging	Het
Psmb5	A	G	14: 54,614,383	Y115H	possibly damaging	Het
Rictor	A	G	15: 6,759,496	N198D	possibly damaging	Het
Rsrc2	A	G	5: 123,739,567		probably benign	Het
Sec16a	C	T	2: 26,425,864	W262*	probably null	Het
Sfmbt1	A	G	14: 30,766,096	D8G	possibly damaging	Het
Sptbn5	T	G	2: 120,076,400		probably benign	Het
Sqor	A	G	2: 122,807,594	D139G	possibly damaging	Het
Sugt1	A	T	14: 79,607,261	T139S	probably benign	Het
Tcp11	G	A	17: 28,071,672	P159S	probably damaging	Het
Tmem262	A	G	19: 6,080,512	T89A	possibly damaging	Het
Tnfaip6	C	A	2: 52,043,783	T50N	probably damaging	Het
Ttll9	T	C	2: 152,984,262	Y131H	probably damaging	Het
Vmn1r173	T	A	7: 23,702,895	M185K	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r52	G	A	7: 10,159,163	T683I	probably damaging	Het
Vps53	A	T	11: 76,134,427	I197N	probably damaging	Het
Wdfy4	C	T	14: 33,047,251	V2086M	possibly damaging	Het
Zfp592	A	T	7: 81,025,486	T733S	possibly damaging	Het
Zfp599	A	G	9: 22,250,242	F209S	probably damaging	Het

Other mutations in Washc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Washc4	APN	10	83550883	missense	probably benign	0.07
IGL01370:Washc4	APN	10	83558830	missense	probably damaging	0.98
IGL01524:Washc4	APN	10	83576132	missense	probably benign	0.37
IGL01682:Washc4	APN	10	83580306	missense	possibly damaging	0.93
IGL01973:Washc4	APN	10	83556109	missense	probably damaging	0.99
IGL02002:Washc4	APN	10	83579543	missense	possibly damaging	0.95
IGL02020:Washc4	APN	10	83564472	missense	probably damaging	0.97
IGL02230:Washc4	APN	10	83581369	missense	probably benign	0.00
IGL02421:Washc4	APN	10	83579550	missense	probably damaging	0.98
IGL02514:Washc4	APN	10	83570083	missense	probably damaging	0.98
IGL02619:Washc4	APN	10	83558853	missense	possibly damaging	0.84
IGL02852:Washc4	APN	10	83583309	missense	possibly damaging	0.95
IGL02870:Washc4	APN	10	83585876	missense	probably benign
IGL03181:Washc4	APN	10	83591019	missense	probably damaging	1.00
IGL03247:Washc4	APN	10	83564463	missense	probably benign	0.02
R0458:Washc4	UTSW	10	83546799	missense	possibly damaging	0.70
R0462:Washc4	UTSW	10	83556913	missense	probably benign	0.00
R0471:Washc4	UTSW	10	83558734	splice site	probably benign
R1144:Washc4	UTSW	10	83580330	missense	probably damaging	0.97
R1560:Washc4	UTSW	10	83556109	missense	probably damaging	0.99
R1789:Washc4	UTSW	10	83579525	missense	possibly damaging	0.92
R1819:Washc4	UTSW	10	83550884	missense	probably benign	0.08
R2421:Washc4	UTSW	10	83579521	missense	probably damaging	0.97
R2882:Washc4	UTSW	10	83579501	missense	possibly damaging	0.93
R2902:Washc4	UTSW	10	83554763	nonsense	probably null
R3436:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R3437:Washc4	UTSW	10	83570002	missense	probably benign	0.33
R3552:Washc4	UTSW	10	83546856	missense	probably benign	0.45
R4646:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4647:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4648:Washc4	UTSW	10	83574543	missense	possibly damaging	0.71
R4732:Washc4	UTSW	10	83574479	missense	probably benign
R4733:Washc4	UTSW	10	83574479	missense	probably benign
R4750:Washc4	UTSW	10	83591052	missense	probably damaging	0.99
R4835:Washc4	UTSW	10	83579512	missense	possibly damaging	0.93
R5024:Washc4	UTSW	10	83583336	missense	possibly damaging	0.71
R5055:Washc4	UTSW	10	83556907	missense	probably damaging	0.99
R5414:Washc4	UTSW	10	83556103	missense	possibly damaging	0.95
R5423:Washc4	UTSW	10	83579554	missense	possibly damaging	0.71
R5428:Washc4	UTSW	10	83574522	missense	probably benign	0.00
R5506:Washc4	UTSW	10	83581337	missense	probably damaging	0.97
R5540:Washc4	UTSW	10	83573793	missense	probably damaging	0.99
R5667:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5671:Washc4	UTSW	10	83570028	missense	probably damaging	0.97
R5777:Washc4	UTSW	10	83555605	missense	probably damaging	1.00
R6369:Washc4	UTSW	10	83574444	missense	probably damaging	1.00
R6370:Washc4	UTSW	10	83571362	missense	possibly damaging	0.85
R6500:Washc4	UTSW	10	83558823	missense	probably damaging	1.00
R6645:Washc4	UTSW	10	83572195	nonsense	probably null
R6829:Washc4	UTSW	10	83560516	missense	probably damaging	0.97
R6862:Washc4	UTSW	10	83558893	missense	possibly damaging	0.92
R6899:Washc4	UTSW	10	83576055	missense	probably benign	0.07
R7144:Washc4	UTSW	10	83573774	critical splice acceptor site	probably null
R7163:Washc4	UTSW	10	83591033	missense	probably damaging	0.99
R7477:Washc4	UTSW	10	83574443	missense	probably damaging	0.99
R7900:Washc4	UTSW	10	83573773	splice site	probably null
R8491:Washc4	UTSW	10	83576123	missense	probably benign	0.24
X0017:Washc4	UTSW	10	83591143	missense	probably damaging	1.00
X0066:Washc4	UTSW	10	83558829	frame shift	probably null
Z1088:Washc4	UTSW	10	83576741	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGGCACTCATATAAGTACATGCAC -3'
(R):5'- GTGCAGTACAAAGAGCCCAC -3'

Sequencing Primer
(F):5'- GTACATGCACATATCCCATCAAAGG -3'
(R):5'- CTGGTCAATTTCAGAAGGCTCAC -3'

Posted On

2018-07-23