Incidental Mutation 'R6657:Washc4'
ID526672
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6657 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83558618 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 269 (F269L)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038388
AA Change: F269L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: F269L

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Meta Mutation Damage Score 0.1674 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6500:Washc4 UTSW 10 83558823 missense probably damaging 1.00
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7983:Washc4 UTSW 10 83573773 splice site probably null
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGCACTCATATAAGTACATGCAC -3'
(R):5'- GTGCAGTACAAAGAGCCCAC -3'

Sequencing Primer
(F):5'- GTACATGCACATATCCCATCAAAGG -3'
(R):5'- CTGGTCAATTTCAGAAGGCTCAC -3'
Posted On2018-07-23