Incidental Mutation 'R6657:Odf4'
ID 526673
Institutional Source Beutler Lab
Gene Symbol Odf4
Ensembl Gene ENSMUSG00000032921
Gene Name outer dense fiber of sperm tails 4
Synonyms Oppo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6657 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68921835-68927081 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68926812 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 18 (N18D)
Ref Sequence ENSEMBL: ENSMUSP00000134383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038932] [ENSMUST00000125134] [ENSMUST00000130271]
AlphaFold Q8VI88
Predicted Effect probably benign
Transcript: ENSMUST00000038932
AA Change: N18D

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040050
Gene: ENSMUSG00000032921
AA Change: N18D

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 42 222 1.1e-8 PFAM
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125134
AA Change: N17D

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133636
Gene: ENSMUSG00000032921
AA Change: N17D

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130271
AA Change: N18D

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134383
Gene: ENSMUSG00000032921
AA Change: N18D

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156828
AA Change: N2D
SMART Domains Protein: ENSMUSP00000133569
Gene: ENSMUSG00000032921
AA Change: N2D

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Csnk1d T C 11: 120,964,994 E405G possibly damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Odf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Odf4 APN 11 68921952 unclassified probably benign
IGL01782:Odf4 APN 11 68926633 missense probably damaging 0.98
BB006:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
BB016:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R1945:Odf4 UTSW 11 68922157 missense possibly damaging 0.53
R4551:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4552:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4685:Odf4 UTSW 11 68922839 critical splice donor site probably null
R4707:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R5163:Odf4 UTSW 11 68922846 missense probably damaging 1.00
R7073:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R7508:Odf4 UTSW 11 68922423 missense possibly damaging 0.71
R7778:Odf4 UTSW 11 68922072 missense probably benign 0.01
R7824:Odf4 UTSW 11 68922072 missense probably benign 0.01
R7929:Odf4 UTSW 11 68922933 missense possibly damaging 0.80
R9425:Odf4 UTSW 11 68922984 missense probably benign
X0025:Odf4 UTSW 11 68926790 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCGCTGATGGAAACGACTC -3'
(R):5'- TCTTGGATCTGGAGCTCAGG -3'

Sequencing Primer
(F):5'- CTTAGAGGGATACAACCATTTCTTGG -3'
(R):5'- ATTCTTGCTCAGACACTAGGC -3'
Posted On 2018-07-23