Incidental Mutation 'R6657:Csnk1d'
ID 526676
Institutional Source Beutler Lab
Gene Symbol Csnk1d
Ensembl Gene ENSMUSG00000025162
Gene Name casein kinase 1, delta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6657 (G1)
Quality Score 206.009
Status Validated
Chromosome 11
Chromosomal Location 120961749-120991330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120964994 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 405 (E405G)
Ref Sequence ENSEMBL: ENSMUSP00000070721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575] [ENSMUST00000168579]
AlphaFold Q9DC28
Predicted Effect probably benign
Transcript: ENSMUST00000018274
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070575
AA Change: E405G

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162
AA Change: E405G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141071
Predicted Effect probably benign
Transcript: ENSMUST00000168579
SMART Domains Protein: ENSMUSP00000125846
Gene: ENSMUSG00000025161

DomainStartEndE-ValueType
Pfam:MFS_1 25 375 8.3e-32 PFAM
transmembrane domain 390 412 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189381
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the casein kinase I (CKI) family of serine/threonine protein kinases. A highly similar human protein regulates an array of cellular processes by influencing the Wnt and hedgehog signaling pathways. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die 1.5 to 5 days after birth and fetal weight is significantly smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T G 8: 105,708,818 L36R probably damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Akr1b7 A C 6: 34,416,200 D106A probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Chst5 C T 8: 111,890,274 R238Q probably benign Het
Cpxm2 T C 7: 132,049,077 Y618C probably damaging Het
Ctsh A T 9: 90,060,502 M37L probably benign Het
Eml5 T G 12: 98,791,405 I1843L probably damaging Het
Ep400 C A 5: 110,693,545 probably benign Het
Fbln2 A G 6: 91,259,750 N749S possibly damaging Het
Gpc5 A G 14: 115,370,198 H404R probably benign Het
Hyal6 A G 6: 24,734,758 D230G possibly damaging Het
Itga5 T C 15: 103,350,795 D735G probably damaging Het
Kansl2 T A 15: 98,524,670 Q339L possibly damaging Het
Lrp4 T A 2: 91,492,053 M1078K probably benign Het
Mmp24 A T 2: 155,798,179 Y143F probably damaging Het
Mroh7 A T 4: 106,702,500 C743* probably null Het
Myh14 T C 7: 44,637,846 N618D probably damaging Het
Myo19 A T 11: 84,897,196 M324L probably benign Het
Nectin2 T C 7: 19,738,140 N108S probably benign Het
Nrg2 A G 18: 36,196,589 I191T probably damaging Het
Odf4 T C 11: 68,926,812 N18D probably benign Het
Olfr1109 T A 2: 87,093,059 I113F probably benign Het
Pcsk2 T G 2: 143,690,366 L145V probably damaging Het
Pdzrn3 C A 6: 101,151,022 Q894H probably benign Het
Pfpl G A 19: 12,429,926 V514I probably benign Het
Plbd1 A T 6: 136,617,252 M333K probably damaging Het
Plec A T 15: 76,178,156 M2554K possibly damaging Het
Psmb5 A G 14: 54,614,383 Y115H possibly damaging Het
Rictor A G 15: 6,759,496 N198D possibly damaging Het
Rsrc2 A G 5: 123,739,567 probably benign Het
Sec16a C T 2: 26,425,864 W262* probably null Het
Sfmbt1 A G 14: 30,766,096 D8G possibly damaging Het
Sptbn5 T G 2: 120,076,400 probably benign Het
Sqor A G 2: 122,807,594 D139G possibly damaging Het
Sugt1 A T 14: 79,607,261 T139S probably benign Het
Tcp11 G A 17: 28,071,672 P159S probably damaging Het
Tmem262 A G 19: 6,080,512 T89A possibly damaging Het
Tnfaip6 C A 2: 52,043,783 T50N probably damaging Het
Ttll9 T C 2: 152,984,262 Y131H probably damaging Het
Vmn1r173 T A 7: 23,702,895 M185K probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r52 G A 7: 10,159,163 T683I probably damaging Het
Vps53 A T 11: 76,134,427 I197N probably damaging Het
Washc4 T A 10: 83,558,618 F269L possibly damaging Het
Wdfy4 C T 14: 33,047,251 V2086M possibly damaging Het
Zfp592 A T 7: 81,025,486 T733S possibly damaging Het
Zfp599 A G 9: 22,250,242 F209S probably damaging Het
Other mutations in Csnk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Csnk1d APN 11 120971567 missense probably benign 0.06
IGL01905:Csnk1d APN 11 120973963 missense probably damaging 1.00
IGL02476:Csnk1d APN 11 120972512 missense probably damaging 1.00
R1971:Csnk1d UTSW 11 120972448 missense possibly damaging 0.95
R2245:Csnk1d UTSW 11 120972403 missense probably damaging 1.00
R4472:Csnk1d UTSW 11 120964974 unclassified probably benign
R4767:Csnk1d UTSW 11 120969128 missense probably benign
R4809:Csnk1d UTSW 11 120963842 unclassified probably benign
R4870:Csnk1d UTSW 11 120983188 intron probably benign
R6522:Csnk1d UTSW 11 120971623 missense probably damaging 1.00
RF009:Csnk1d UTSW 11 120971627 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGGATGCCACTGATTCCCC -3'
(R):5'- GCACTGTGTGGAGAGACTTG -3'

Sequencing Primer
(F):5'- ACTGATTCCCCCAGACTGG -3'
(R):5'- AGAGACTTGCCGTGAGCTG -3'
Posted On 2018-07-23